Busch Lab

ZMP

foxl1

Ensembl ID:
ENSDARG00000008133
ZFIN ID:
ZDB-GENE-040426-1181
Description:
forkhead box protein L1 [Source:RefSeq peptide;Acc:NP_957278]
Human Orthologue:
FOXL1
Human Description:
forkhead box L1 [Source:HGNC Symbol;Acc:3817]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa1842 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1842
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018764 Nonsense 79 360 1 1
Genomic Location (Zv9):
Chromosome 18 (position 17144262)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17496028
GRCz11 18 17485094
KASP Assay ID:
554-1833.1 (used for ordering genotyping assays)
KASP Sequence:
ATGGCAATCAAGAACGCGCCGGACAAGCGCGCGACCCTCAGCGGGATCTA[T/A]CAGTTCATCATGGACCGCTTCCCATATTATCACGACAACAAACAAGGTTG
Associated Phenotype:
Not determined