Busch Lab

ZMP

pcdh15b

Ensembl ID:
ENSDARG00000008127
ZFIN ID:
ZDB-GENE-050214-1
Description:
protocadherin 15b [Source:RefSeq peptide;Acc:NP_001012504]
Human Orthologue:
PCDH15
Human Description:
protocadherin-related 15 [Source:HGNC Symbol;Acc:14674]
Mouse Orthologue:
Pcdh15
Mouse Description:
protocadherin 15 Gene [Source:MGI Symbol;Acc:MGI:1891428]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa35208 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30955 Nonsense Mutation detected in F1 DNA Not yet available
sa45449 Nonsense Mutation detected in F1 DNA Not yet available
sa22027 Nonsense Available for shipment Available now
sa22026 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35208
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074053 Essential Splice Site 276 1848 6 29
ENSDART00000106391 Essential Splice Site 276 1848 6 31
ENSDART00000133868 None None 1160 None 16
Genomic Location (Zv9):
Chromosome 12 (position 7451481)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6734212
GRCz11 12 6767715
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCCAGCCTCCGTCAGACCGCCCAGGAATCCTGTACTCTATCCTCATAG[G/A]TAAGTCGCCATCAGACTCTAGCCATTCTCTCTATAAAGCAGCATCTACAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27885
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074053 Essential Splice Site 790 1848 16 29
ENSDART00000106391 Essential Splice Site 790 1848 16 31
ENSDART00000133868 Essential Splice Site 102 1160 1 16
Genomic Location (Zv9):
Chromosome 12 (position 7354234)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6636965
GRCz11 12 6670468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACACTGCCAGAAAACAGCCCAGTGGGGACTGTCATCCTCAACATCAGTG[T/A]AAGTTACACACACACACACACACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30955
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074053 Nonsense 911 1848 19 29
ENSDART00000106391 Nonsense 911 1848 19 31
ENSDART00000133868 Nonsense 223 1160 4 16
Genomic Location (Zv9):
Chromosome 12 (position 7326005)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6608736
GRCz11 12 6642239
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTTTTTAACATTTTCATTATTGTTGTCTTTTAGGGTACAGCGGCAAGT[C/T]GAGTTCACTATAAAGCGGATCTGGAGCAGTTTCCTTACAGCACTAGTATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19026
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074053 Essential Splice Site 1027 1848 21 29
ENSDART00000106391 Essential Splice Site 1027 1848 21 31
ENSDART00000133868 Essential Splice Site 339 1160 6 16
ENSDART00000074053 Essential Splice Site 1027 1848 21 29
ENSDART00000106391 Essential Splice Site 1027 1848 21 31
ENSDART00000133868 Essential Splice Site 339 1160 6 16
Genomic Location (Zv9):
Chromosome 12 (position 7296426)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6579157
GRCz11 12 6612660
KASP Assay ID:
2260-4953.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAATAAACCAAACCATCGTCTACTCTATCATTGAAGGAAATGAAGGCGG[T/A]GAGTGCTAACCGGATTTGCATAATATGTTTAGTGAATCAAGTGCTAAAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3829
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074053 Essential Splice Site 1027 1848 21 29
ENSDART00000106391 Essential Splice Site 1027 1848 21 31
ENSDART00000133868 Essential Splice Site 339 1160 6 16
ENSDART00000074053 Essential Splice Site 1027 1848 21 29
ENSDART00000106391 Essential Splice Site 1027 1848 21 31
ENSDART00000133868 Essential Splice Site 339 1160 6 16
Genomic Location (Zv9):
Chromosome 12 (position 7296426)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6579157
GRCz11 12 6612660
KASP Assay ID:
2260-4953.1 (used for ordering genotyping assays)
KASP Sequence:
GCAATAAACCAAACCATCGTCTACTCTATCATTGAAGGAAATGAAGGCGG[T/A]GAGTGCTAACCGGATTTGCATAATATGTTTAGTGAATCAAGTGCTAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45449
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074053 Nonsense 1524 1848 29 29
ENSDART00000106391 Nonsense 1524 1848 31 31
ENSDART00000133868 Nonsense 836 1160 16 16
Genomic Location (Zv9):
Chromosome 12 (position 7251066)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6533797
GRCz11 12 6567300
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGACGAATCTCAGCGGAGTAGGAGGGTGGTGATGGATCCAGTTCAGTGG[G/T]AGCTGCAGCTGCTAAAGGCCAGCCTTAAGGACAGCAAGGAGATGATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22027
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074053 Nonsense 1655 1848 29 29
ENSDART00000106391 Nonsense 1655 1848 31 31
ENSDART00000133868 Nonsense 967 1160 16 16
Genomic Location (Zv9):
Chromosome 12 (position 7250673)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6533404
GRCz11 12 6566907
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGAGGTCAATGTGGAGATCATTCCAGACCCTCCTGATGTACCTGCTCCA[C/T]AACCACCACCACCGCCTCCACCTCCCTCCAGTCCGCCCCCACCCCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22026
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074053 Nonsense 1807 1848 29 29
ENSDART00000106391 Nonsense 1807 1848 31 31
ENSDART00000133868 Nonsense 1119 1160 16 16
Genomic Location (Zv9):
Chromosome 12 (position 7250217)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6532948
GRCz11 12 6566451
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAAAAGCAGCGCCCACTAGTGATCAACCCTAAACCGCAAGTGTCTGTC[G/T]AACCAGAGGCTGGTGTAACAGAGGCGGAGCCTGCTCAAGAAGGACCACCA
Associated Phenotype:
Not determined