Busch Lab

ZMP

src

Ensembl ID:
ENSDARG00000008107
ZFIN ID:
ZDB-GENE-030131-3809
Description:
protein-tyrosine kinase [Source:RefSeq peptide;Acc:NP_001003837]
Human Orthologue:
SRC
Human Description:
v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) [Source:HGNC Symbol;Acc:11283]
Mouse Orthologue:
Src
Mouse Description:
Rous sarcoma oncogene Gene [Source:MGI Symbol;Acc:MGI:98397]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa31093 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31093
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102843 Nonsense 91 534 3 12
ENSDART00000112198 Nonsense 91 534 2 12
Genomic Location (Zv9):
Chromosome 23 (position 39560253)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39521818
GRCz11 23 39414729
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTCTTGTGTTTTTCCATAGGCGGCGTGACCACATTTGTGGCTCTGTA[T/G]GACTACGAGTCACGAACCGCCTCCGATTTGTCATTCAGGAAAGGAGAACG
Associated Phenotype:
Not determined