Busch Lab

ZMP

slc7a10

Ensembl ID:
ENSDARG00000008100
ZFIN ID:
ZDB-GENE-080116-1
Description:
Slc7a10 protein [Source:UniProtKB/TrEMBL;Acc:B0JZP9]
Human Orthologue:
SLC7A10
Human Description:
solute carrier family 7, (neutral amino acid transporter, y+ system) member 10 [Source:HGNC Symbol;A
Mouse Orthologue:
Slc7a10
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 10 Gene [Source:MGI Sym

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa21020 Essential Splice Site Available for shipment Available now
sa21019 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21020
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075782 Essential Splice Site 48 509 2 11
Genomic Location (Zv9):
Chromosome 7 (position 39728422)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38065062
GRCz11 7 38336320
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATATATAAAAAACTAAACAACCCATTGCTGTTTCTCTTGTTTTTTTCA[G/T]GCAACATCATTGGCTCAGGGATCTTCATCTCTCCAAAGGGGGTTCTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21019
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075782 Nonsense 460 509 10 11
Genomic Location (Zv9):
Chromosome 7 (position 39712526)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38049166
GRCz11 7 38320424
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGTGTGTGGGATGGGGCTGGTGATCATGCTCACTGGAGTCCCCATCTA[T/A]TTCATTGGAGTGCAGTGGAAGAACAAACCACAGTGGATATACAGCGCAAT
Associated Phenotype:
Not determined