Busch Lab

ZMP

si:dkey-217m5.5

Ensembl ID:
ENSDARG00000008060
ZFIN ID:
ZDB-GENE-041014-317
Description:
Novel protein similar to human and mouse scavenger receptor class A, member 3 (SCARA3) [Source:UniPr
Human Orthologue:
SCARA3
Human Description:
scavenger receptor class A, member 3 [Source:HGNC Symbol;Acc:19000]
Mouse Orthologue:
Scara3
Mouse Description:
scavenger receptor class A, member 3 Gene [Source:MGI Symbol;Acc:MGI:2444418]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa12458 Nonsense Available for shipment Available now
sa29429 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29428
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002481 Essential Splice Site 29 586 3 7
ENSDART00000146683 Essential Splice Site 15 578 1 5
Genomic Location (Zv9):
Chromosome 20 (position 39315064)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39387476
GRCz11 20 39290355
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTAGAGGAGGACTTAACTGGAGAAGAAGAGGAAATTCCTCCCCTGAGAG[G/A]TTAGAAAAATTCATCTTTCCTAAAGATTATTGCTTTTCATATTCACCACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4923
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002481 Nonsense 87 586 5 7
ENSDART00000146683 Nonsense 73 578 3 5
Genomic Location (Zv9):
Chromosome 20 (position 39320481)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39392893
GRCz11 20 39295772
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTCAGGAGAGTTGACAGCTTGTATGAAGATGAATCATTTTACCACAAA[C/T]AGATGTCCAAAGTAGAGGAAAGTGTAAAAGGCAAGAAATCTAATTGCATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4126
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002481 Nonsense 108 586 6 7
ENSDART00000146683 Nonsense 100 578 4 5
Genomic Location (Zv9):
Chromosome 20 (position 39322414)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39394826
GRCz11 20 39297705
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTTGTTCTTCTGCAGATATCAGAACAGCAAGCAACTATTCCACTTGCT[T/G]AGACGTGKCACAGTTCCAAGAGGAGATTGCCAGACTGAAGAAGGAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12458
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002481 Nonsense 137 586 6 7
ENSDART00000146683 Nonsense 129 578 4 5
Genomic Location (Zv9):
Chromosome 20 (position 39322500)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39394912
GRCz11 20 39297791
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAAGAAGGAGTTWGAAGAAATCCAGAAGACGATACTCAGTCAAGAGCAA[C/T]AGATGAATGAGGCGACCCAAWCCCAGCAAAGTCTTACACAATCCAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29429
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002481 Nonsense 323 586 6 7
ENSDART00000146683 Nonsense 315 578 4 5
Genomic Location (Zv9):
Chromosome 20 (position 39323060)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39395472
GRCz11 20 39298351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGAGCACGAGGAGAACATGCATGACCACCAGTACCACGCCAAGTATTA[T/A]GAGAACCGTACTGGGGAGCGATTTGTCACTTTGGATGCAAGAATGGACTC
Associated Phenotype:
Not determined