Busch Lab

ZMP

mxg

Ensembl ID:
ENSDARG00000008019
ZFIN ID:
ZDB-GENE-030721-10
Description:
myxovirus (influenza virus) resistance G [Source:RefSeq peptide;Acc:NP_001116443]
Human Orthologues:
AC019294.4, MX1, MX2
Human Descriptions:
Putative UPF0621 protein C [Source:UniProtKB/Swiss-Prot;Acc:A8MV40]
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) [Source:HGNC Symb
myxovirus (influenza virus) resistance 2 (mouse) [Source:HGNC Symbol;Acc:7533]
Mouse Orthologues:
Mx1, Mx2
Mouse Descriptions:
myxovirus (influenza virus) resistance 1 Gene [Source:MGI Symbol;Acc:MGI:97243]
myxovirus (influenza virus) resistance 2 Gene [Source:MGI Symbol;Acc:MGI:97244]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24663 Essential Splice Site Available for shipment Available now
sa24664 Nonsense Available for shipment Available now
sa7260 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24663
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104340 Essential Splice Site 241 628 5 13
Genomic Location (Zv9):
Chromosome 25 (position 20193854)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19605831
GRCz11 25 19703782
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATTAAAACTTGCACAAGAAGTAGATCCTGAGGGCAAAAGAACTATTGG[T/A]AATGTAATACAGAACACCTGTATATAAACACACACGCAAACATTAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24664
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104340 Nonsense 369 628 8 13
Genomic Location (Zv9):
Chromosome 25 (position 20198079)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19610056
GRCz11 25 19708007
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGATCTAAAAGAGTGTGAGTCTGGACCCCCACAGGATTCAAAAGGGGCC[A/T]AACAATTTCTTATTAAAGTAAGAAGTTTTAATTATCCCATCTAGCAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7260
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104340 Nonsense 421 628 10 13
Genomic Location (Zv9):
Chromosome 25 (position 20200680)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19612657
GRCz11 25 19710608
KASP Assay ID:
554-4931.1 (used for ordering genotyping assays)
KASP Sequence:
AAAGTATTSTCTTTTAATAAGAAATGCATATTGTTCTCCAACAAGTAAAA[C/T]AATCAACTAAAGAGAAAATAGAGGTTCTCCAGAATTTCAGAGGGAGAGAA
Associated Phenotype:
Not determined