Busch Lab

ZMP

si:ch211-220f16.2

Ensembl ID:
ENSDARG00000007976
ZFIN ID:
ZDB-GENE-070912-199
Human Orthologues:
AC104809.3, CEP110, CEP250, CROCC, GOLGA4
Human Descriptions:
centrosomal protein 110kDa [Source:HGNC Symbol;Acc:1858]
centrosomal protein 250kDa [Source:HGNC Symbol;Acc:1859]
ciliary rootlet coiled-coil, rootletin [Source:HGNC Symbol;Acc:21299]
golgin A4 [Source:HGNC Symbol;Acc:4427]
Mouse Orthologues:
Cep110, Cep250, Crocc, Golga4
Mouse Descriptions:
centrosomal protein 110 Gene [Source:MGI Symbol;Acc:MGI:1889576]
centrosomal protein 250 Gene [Source:MGI Symbol;Acc:MGI:108084]
ciliary rootlet coiled-coil, rootletin Gene [Source:MGI Symbol;Acc:MGI:3529431]
golgi autoantigen, golgin subfamily a, 4 Gene [Source:MGI Symbol;Acc:MGI:1859646]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa1393 Nonsense F2 line generated Not yet available
sa2986 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa1393
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016986 None None 1223 None 18
ENSDART00000136073 Nonsense 66 266 3 7
Genomic Location (Zv9):
Chromosome 18 (position 29967718)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30039975
GRCz11 18 30018229
KASP Assay ID:
554-1305.1 (used for ordering genotyping assays)
KASP Sequence:
AGTTGATCAGGGAGAAAGATGCAGTACTCAGCAGTAAAGATGAGCAAGTC[A/T]AGGTAATTTCTGTTTCTGAAAGAATATTTTCTGTGTCAGTGCAATGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2986
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016986 Nonsense 5 1223 1 18
ENSDART00000136073 Nonsense 71 266 4 7
Genomic Location (Zv9):
Chromosome 18 (position 29964100)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30036357
GRCz11 18 30014611
KASP Assay ID:
554-3366.1 (used for ordering genotyping assays)
KASP Sequence:
TATTTGCCATAATTTATGTGTGTGTGTNNNNTTGTTTGGTAGGAGCTGACAGAA[C/T]AAATGCAGCGCTTGCGGAGTGAGAGAGAACACTCTGAATCAAAGCTGGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29052
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016986 Nonsense 556 1223 12 18
ENSDART00000136073 None None 266 None 7
Genomic Location (Zv9):
Chromosome 18 (position 29929815)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30002072
GRCz11 18 29980326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAACTAAAACAAGAAATGAAGCTCAAAGAGGATGTGCTGACTAAAGTC[G/T]AAGAAAATGTTCAAATCTTTAGAGACCCGCAGCTTTCCGACCAGCAGTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
hu7872
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016986 Nonsense 1057 1223 15 18
ENSDART00000136073 None None 266 None 7
Genomic Location (Zv9):
Chromosome 18 (position 29928060)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 30000317
GRCz11 18 29978571
KASP Assay ID:
554-2401.1 (used for ordering genotyping assays)
KASP Sequence:
GCATTCAAGGTTTTTCTCTCTTAAAGTGTTTTCTTTCTCTTCTAAAGCCT[G/A]GTTCAGTCTGGAGCACTCCWCTYTCAGAGAKCTTATCTCTTGTTGAGAGG
Associated Phenotype:
Not determined