Busch Lab

ZMP

hibadhb

Ensembl ID:
ENSDARG00000007959
ZFIN ID:
ZDB-GENE-040426-1582
Description:
3-hydroxyisobutyrate dehydrogenase b [Source:RefSeq peptide;Acc:NP_957454]
Human Orthologue:
HIBADH
Human Description:
3-hydroxyisobutyrate dehydrogenase [Source:HGNC Symbol;Acc:4907]
Mouse Orthologue:
Hibadh
Mouse Description:
3-hydroxyisobutyrate dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:1889802]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa2861 Nonsense F2 line generated Not yet available
sa5622 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28640
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006429 Nonsense 23 329 1 8

The following transcripts of ENSDARG00000007959 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 22955571)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21065322
GRCz11 16 20871141
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGTCTCGCGGTGTCTGGTAGGAAAGTGTAACAACCATGTCAACGCCGTG[C/T]AGGGTAATGTGTTATCTTATAACGTTATGCTTATATCTGCTACTGTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2861
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006429 Nonsense 72 329 2 8
ENSDART00000006429 Nonsense 72 329 2 8

The following transcripts of ENSDARG00000007959 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 22958695)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21068446
GRCz11 16 20874265
KASP Assay ID:
554-3070.1 (used for ordering genotyping assays)
KASP Sequence:
GATATCCAGTGATCGCCACAGATGTATTTCCAGAATCTTGCAAAGAGCTG[C/T]AGGAACTCGGAGCTCAGGTCAGGATAACAGACATAAAACTTTATAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5622
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006429 Nonsense 72 329 2 8
ENSDART00000006429 Nonsense 72 329 2 8

The following transcripts of ENSDARG00000007959 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 22958695)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21068446
GRCz11 16 20874265
KASP Assay ID:
554-3070.1 (used for ordering genotyping assays)
KASP Sequence:
GATATCCAGTGATCGCCACAGATGTATTTCCAGAATCTTGCAAAGAGCTG[C/T]AGGAACTCGGAGCTCAGGTCAGGATAACAGACATAAAACTTTATAACATC
Associated Phenotype:
Not determined