Busch Lab

ZMP

jak2a

Ensembl ID:
ENSDARG00000007915
ZFIN IDs:
ZDB-GENE-980526-481, ZDB-GENE-980526-481
Description:
Janus kinase 2a [Source:RefSeq peptide;Acc:NP_571168]
Human Orthologue:
JAK2
Human Description:
Janus kinase 2 [Source:HGNC Symbol;Acc:6192]
Mouse Orthologue:
Jak2
Mouse Description:
Janus kinase 2 Gene [Source:MGI Symbol;Acc:MGI:96629]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37192 Nonsense Mutation detected in F1 DNA Not yet available
sa14232 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37192
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004255 Nonsense 183 1095 6 24
ENSDART00000127639 Nonsense 183 1095 7 25
Genomic Location (Zv9):
Chromosome 21 (position 216116)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 238207
GRCz11 21 259659
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACCCCAGCACCGCTCATGACCCCTGACCCCTGTGTTCCTCCGCAGTTA[T/G]AAGTCGTTTCTGCCGAAGAACATGCGGGAGCACATCCAGAACCAGCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14232
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004255 Essential Splice Site 1023 1095 23 24
ENSDART00000127639 Essential Splice Site 1023 1095 24 25
Genomic Location (Zv9):
Chromosome 21 (position 208158)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 246165
GRCz11 21 267617
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGTCTGTACGCTCAGTGATGATCAATTCTCCTGATGCTGTGCTGTGTTC[A/T]GGTGTTCATGGAGCAGATGGGTGAGGATAAACAGGGTCAGATGATCGTCT
Associated Phenotype:
Not determined