Busch Lab

ZMP

crnkl1

Ensembl ID:
ENSDARG00000007901
ZFIN ID:
ZDB-GENE-040426-694
Description:
crooked neck-like protein 1 [Source:RefSeq peptide;Acc:NP_957240]
Human Orthologue:
CRNKL1
Human Description:
crooked neck pre-mRNA splicing factor-like 1 (Drosophila) [Source:HGNC Symbol;Acc:15762]
Mouse Orthologues:
AC153386.1, AC156399.1, Crnkl1
Mouse Description:
Crn, crooked neck-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1914127]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43537 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43537
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112689 Essential Splice Site 67 754 2 14
Genomic Location (Zv9):
Chromosome 20 (position 49387595)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49274743
GRCz11 20 49082676
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCACCGATAAAGAAGAGCTCAATGACTACAAACTGAAAAAGAGAAAGG[T/A]ATGAAATGTTGTATCACCATGTAGTATACCATGGTGTCACTATATGCATA
Long Flanking Sequence:
TAAGCTTATTTTTTTATAATGTATTTGTGTTTGTGTTCAGGTGAAGAATAAACCCCTGTAAGTTAGCATTAGCATGTAAACAACATGTAGTTCTGCTAACGTTACTTTATAATTAGTTAACTGATGTATAATGTGTATACATGTAATCAGTTGAGTTAAAGGTTGTCTTGCTTTGTAATGGTTTTGTATTAATGCTCATGTGAAGAATAAAGCTGTGAGTTAGCATTAGCTTGTAAACAACGTGAACTTGTGCCACTCTGAAAATAACAACTGTATAATGTATAGAACTATAACCAGATGGGTTAAAGATTGTCTTGTTTTGTAATGGTTTTGTGTTTGTGTTCAGGTGAAGAATAAAGCCCCTGCAGAGGTGCAGATCACCGCCGAGCAGCTGCTCAGAGAGGCCAAAGAGAGAGAGCTCGAGCTGCTGCCACCGCCACCCAAACAGAAGATCACCGATAAAGAAGAGCTCAATGACTACAAACTGAAAAAGAGAAAGG[T/A]ATGAAATGTTGTATCACCATGTAGTATACCATGGTGTCACTATATGCATATGTCATAAAGTAGTACTAAATTACTGTGCATGTACTGAAAGCTTGGTTCTGTCATGGCATATGCCTCAAAAATATACAGTAGTGTCACAATTGCTTATAGAATGTGCGCAGTGCTATCATGATGTTCAGAAAATATGGTATTGATATGGTGTGTAGATTATAAAAGATGATATCGCTATGGTTTAAATGTATTATTTTATTATGGTAAACCTCTAGAAAACATGGGCATTATCACAGTGCATATTCAGAAAACTCAGAGGATATGCAATGTCTTGTTGGGTTTATAGTTGACCAGAAGACAGTTTATATATGTATATAAAGTGGAAGTCTGCCTGTGTTTTATGGACTGCCGCTGTATGAACATTTCAAGAACGTATAAAGCATCCAGGTGTAACGCTTCTCTTCCTGAAGACGCAAATCACTCAGGCGGACACAGAGAACTGCGTTCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29467
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112689 Nonsense 159 754 5 14
Genomic Location (Zv9):
Chromosome 20 (position 49392621)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49279769
GRCz11 20 49087700
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTATTTATATGTTTGTGCCACAGGTACAAGTACACGTATATGGAG[G/T]AGATGCTGGGCAACATTGCAGGCTGCAGGCAGGTGTTTGAGCGCTGGATG
Long Flanking Sequence:
ACAAAACTTAATCTTAAAGACATAGTTCACCCAAACAATTAAAATTCTGTCAGGATTTGCTCATTTTTCAGTTGTTCCAAACCTATTTAAGTTTCTTTCGTCCATTGAACACAAAAGAAGACATACTGAGAAACGTTGGAGACCTGCAACCATTGACTTCCAGATCCTTTGTTTTCCCTACTAAGAAGGTCAAGGGTTACAGGTTTGCAACATTCTTTAAAATAACTTCTTTTGTGTTCAACTGATCAAACCTCAAATTGGTTTGGAACAAGTCAAGGGGGAGTAAATGATGACAAATTTACATTTTTGTGTGAGCAATCCCTTTAATAACAAGTGTAAACAGGCCAAAGGTTATATTTCTGTTTGAATCCTTGATGTGTGTTTTCTTTCTTTTAAAAGACATTTTAGATCAAATCATCTTCTAAATAAATGCATGTCATTTCTGAATGATTGTTTTATTTATATGTTTGTGCCACAGGTACAAGTACACGTATATGGAG[G/T]AGATGCTGGGCAACATTGCAGGCTGCAGGCAGGTGTTTGAGCGCTGGATGGAGTGGGAACCGGAGGAGCAGGCCTGGCATTCATACATCAACTTTGAGCTGCGCTATAAGGAGGTGGACAAGGCCCGCAGCATCTATGAGAATTATATCCTTTCATGAATAATTCATTTCACTTCGAAAATATAGCATACAGTTGAAGTCAAAATTATTAGCGACTGTTAGCAGTAGGGTTGTAACAATATACCGGTATGACGGTTTACCACGATTTGAACGTGCACGATTATCATACCATGAACAATTGCATATCAACGGTTTTAACCCTTAAAGACCGAGACAGCCGCCCGCGGCTAAAAATAAGTATTGCTCTTAAATGTTTAATAACTTTTGATCCGCTGATCCGATTCATAAAATTCAAAGATTGGCATAAAGAAGAGAATCTCAGCTTTCCAGTGCTGTATCACATAACATTCGCGGACTTTCAGAGGCTCCGGAATCAGTGCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29468
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112689 Nonsense 230 754 6 14
Genomic Location (Zv9):
Chromosome 20 (position 49394124)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49281272
GRCz11 20 49089192
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGTGAAGAACTGGATCAAATATGCCCACTTTGAGGAGAAGCACGGCTA[T/A]GTTGCTCGTGGCAGGAAAGTGTTTGAGCGAGCTGTGGAGTTTTTCGGTGA
Long Flanking Sequence:
GTAACTATTTATAGTATAGTAAATATTTATTTATTCTATTTTTTACTGAGGATTTGCACCATGTTTATTTGGACTTTATTTGTACTTTGACACATTATTTATTATTTTCTTATTTTTTTATTTGTTCATTGTAAGTGGTGTTGTTTATAGTAACTAAAAATATATTATTTGGAAAAAGTCAAATTTGCTTCACTGTTCTATTATTTTGTAACATTTGTAACATACCGTATACTGCAAAACCGTCAAACCGTGGTATTGTTTTAGACGATTATCATACCGTGAAAAATTCATACCGTTACAACCCTAGTTAGCAGTAATATTAGAGACTGATCTGACTCCATGCATCCCTATTAGTTATGTTATTTCTTATTTGTAAAGGCATGCATGGCTGTTACATACAAAATTCTAGTTGCGTTGCTTAACCTCAGAGCACTTGTGATGGTCCATCCTGAGGTGAAGAACTGGATCAAATATGCCCACTTTGAGGAGAAGCACGGCTA[T/A]GTTGCTCGTGGCAGGAAAGTGTTTGAGCGAGCTGTGGAGTTTTTCGGTGAAGAACAGGTCAGCGAGAATCTCTACGTGGCTTTTGCCAGATTTGAGGAGAAGCAGAAAGAGGTACGACTTACTCTGTTTGTGTCGTCGGGCACATATGAGACGTTTCTGATGTTTCCTGTCCATACATGATCGTTTCTGTTTGTGTTTCTCAGTTTGAGAGAGTTCGAGTCATCTATAAATACGCTTTAGACCGAATCCCCAAGCAACAGGCCCAGGAGCTGTTCAAGAACTACACTGTGTTTGAGAAGAGGTTTGGAGACAGGAGGGGAATCGAGGACGTGATCGTCAGCAAGAGGAGGTTTCAGTACGAAGAGGAGGTCAAAGTGAGTGACAACGGCATAGTTTATATATAAGAAAAATCACATTTTAGATAATAAAAAAAGTCTTAGTATTGTTCTGTTTGGACTCTCCAGACAACATCACTGTCATGTGTGACAACACTCTTTCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6651
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112689 Nonsense 535 754 12 14
Genomic Location (Zv9):
Chromosome 20 (position 49404882)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49292007
GRCz11 20 49099916
KASP Assay ID:
554-4682.1 (used for ordering genotyping assays)
KASP Sequence:
GGAAATCCTACATTGACTTTGAGATCGAGCAGGARGAATACGACAACACA[C/T]GAGGACTGTATAAGAGATTGTTACAGCGCACTCAACATGTCAAAGTARGC
Long Flanking Sequence:
AGATGTACATATTTTATTTTTAATTTTTGCGTGACCACCGTTACAAAGGACTGGATATCTATAAAGAATTTTGCACAGAATATATATTCACATATTGCAGGAAAGGACATTGTGATGTCTTAAAGCATAGTGTTGGAGATTTAGCTACCCTTTAATGTTCTCTTATTTATGAAAAACATTTAAAGTTCTAAAGCAGCTGTTTCCTTGAAAAAGGCGTGGAAGTGTCATTCGAAACTGAATTGGAAAAAACTTTATTTTAATATAGTCAGACGTGAACTTTGGTGGGCCGGTCTACGGTTTGAAACTCCAGGGCTGAAAAGAAGTTCCACTCCGGGCCTAAAAGCATTTCTCTTAAATCCTCACTGGAAGCAAAGCGTCTAATTCTTGCAATGTTTAAACAAAGCTAGTTTTAACTATTTCCCTGCTGTATTTTTCTCCATCAGGTGTTGTGGAAATCCTACATTGACTTTGAGATCGAGCAGGAAGAATACGACAACACA[C/T]GAGGACTGTATAAGAGATTGTTACAGCGCACTCAACATGTCAAAGTAAGCATCAAAGACTGGCAGAGACCACATGCTCATCTTTAAGGACTACGTGAATGTAATGTTGTTGTGCTGTAGGTCTGGATCAGCTACGCTCAGTTTGAGCTGTCCATCGACACAGAAGACCGCGTGCAGAGGTGCAGACAGGTCTACGAGGAGGCCAATAAGGGCATGCAGAACTGCGAGGAGAAAGAGGAGCGTCTGATGCTCTTGGAGTCCTGGAGAGACTACGAGGAGGAGTTCGGATCCTTCACCCACAAGGAGAGAGTCCGCAAACTCCTGCCGGAGAAGGTGAAGAAGAGGAGGAAGATCACGGCGGAGGATGGGGTGAGTGATCATTCTGTCCTCGTGGCAGGAGTTTTTAAGGCAGTGTTTTTTCAGGACACATTACACATTTCAGTTATAATACATTTATTAATACATAATACTAGAAATGATCAGGATTTTTGCAGCTGGTAC
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Stage Entity Quality Tag
Pharyngula:Prim-5
ZFS:0000029
whole organism
ZFA:0001094
necrotic
PATO:0000647
abnormal
PATO:0000460