Busch Lab

ZMP

csf1ra

Ensembl ID:
ENSDARG00000007889
ZFIN ID:
ZDB-GENE-001205-1
Description:
Macrophage colony-stimulating factor 1 receptor [Source:UniProtKB/Swiss-Prot;Acc:Q9I8N6]
Human Orthologue:
CSF1R
Human Description:
colony stimulating factor 1 receptor [Source:HGNC Symbol;Acc:2433]
Mouse Orthologue:
Csf1r
Mouse Description:
colony stimulating factor 1 receptor Gene [Source:MGI Symbol;Acc:MGI:1339758]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15067 Nonsense Available for shipment Available now
sa9484 Essential Splice Site Available for shipment Available now
sa22726 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15067
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098594 Nonsense 329 960 5 20
Genomic Location (Zv9):
Chromosome 15 (position 43678363)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 3197113
GRCz11 14 3169634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGTGAGCGAAGGAGACGATGTGGATCTCGGGGTTTTGATCGAAGCGTA[T/A]CCTCCTCTGACTTCACAMAAGTGGGAGACRCCCACATCCCATAATGCCTC
Long Flanking Sequence:
TTAGGCAGCCGCAAGGTTTATTTTTTCTGGATTGCTTTTGAAAACACTATCGGTTGGGTTTAGGGAAGGGATGGATAGGGCGTCAGCTGGTCAGTCAGTCAACAGCAGCCTTTACACAAGAAGAGCAGGCACAAATGGCACTCGTGAGAGAAATTTGAGATCTGAAAAGTATACACAGTGACCTCCTGGGACGTATTTGGCACTCTCCAAAAATGTATACAGGGGTACATTTTCAGAAATTTGTGTTTCCTCTTTTACTTGATTAAAGAATTTAAACTGGAAAATCTGTAAAGGTGACAATTGTCTATTGATGTTGTGAATTGTATCTCTTAGCAATAAAAACTTACATAAATAAATCTACTAATGCACTTGTTGTCTGTGACAGAGGAGCCGTACATTCGACTGTCGCCAAAGCTCTCTTCTAAACTCACACACCGCGGTCTGTCCATCGAGGTGAGCGAAGGAGACGATGTGGATCTCGGGGTTTTGATCGAAGCGTA[T/A]CCTCCTCTGACTTCACACAAGTGGGAGACGCCCACATCCCATAATGCCTCACTTCCAGAGAACAGGTTTTTCAACCATAACGACAGGTCAGTTGAACATCATCGCTAATGTATTTTTAAAATTATTTTACATGTTTATTGAGAATTGCTCATAGTGTTAAAGTGTTAATGGAATGAATGAACGAACAAATTGATGGATGGATGGATGGATGGATGGATGGATGGATGAATGTATGAATGAATAAATGGATGGATAGATGAATGAAGGAAGGAAGGAAGAAAGGAAGGAAGGAAGGAAGAAAGGTAGGAATTAATAAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAAGCAATTAATGAAGGAAATAATGAAATAATGAATAAATTGATGGATCAATGGAAGTATGAATAAATGAATAAATTGATGGATGAATGAATGAAGGAAGTAGGGAAGGAAGGAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9484
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098594 Essential Splice Site 642 960 12 20
Genomic Location (Zv9):
Chromosome 15 (position 43686401)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 3189075
GRCz11 14 3161596
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCCAGCATAAGAACWTCGTCAACCTGCTSGGTGCCTGCACACATGGAGG[T/C]ASGACACACACTGGATTTTCCTTTCKATTCTGTACCATTTTTGCTTCATC
Long Flanking Sequence:
GAATGTCATATTATTTCACCATCTTTACACCAAAATAAATAGTGAATGTGCGTGTCTGTGGGTGGGGCTGTGTCGGTGTGGTAATGTGGGCTGGTGTGGCAACAGTGCCAGGGCTAAATTTTTGTCCCAGTCCATCCCAGGTTTGCTCCAACACAGCTGATGCAACAATGAAGGTGTTCGAGACTTTTTTGAACACCTTGATTAGTTGGATCATCTGTGTTTAACTAAGGCTGTATTGATTTTATTTCTCACAATTTAGAAACTTTTGCTCATCATTTAATAACTTACAATTCTTAATAACTTAAAAAAAACAAGACATTAGTGTCATTATTGAGTGTATGGACTGTTGGAGTGAGTAGTGTTGTGTTGTGTTGCATGCTGGGAGCAGCCAGTGCTCATCCTGATGAACGTGAGGCTCTGATGTCTGAGCTGAAAATCCTCAGTCACCTCGGCCAGCATAAGAACATCGTCAACCTGCTGGGTGCCTGCACACATGGAGG[T/C]AGGACACACACTGGATTTTCCTTTCGATTCTGTACCATTTTTGCTTCATCTGTGGTGTATTTACAGGGCCTGTGCTGGTCATCACGGAGTACTGTTGTCATGGCGACCTGCTGAACTTCCTGCGCAGCAAAGCGGAAAACTTCCTGAACTTCGTCATGACCATACCCAACTTTCCAGAACCCATGACGGATTATAAGAACGTCAGCACCGAGCGAATGTTTGTCAGGAGGTCAGTTTAACAAACAGCCATCCACTATTAAACCCTGTTTCCACTGAGAGGTACAGTACGGTACGGGTCACCTTTAGCAGGCTTGCGTTTCCACTGCCAAAAGGGTACCTTTTTGGACAACCCAGGCTCATTGTGGAAACGTAGTCCCGCGGACGTTCCGCAGGCAGGTACGTACGGCTGCAGTTTTTGTTTTTGTGAATCCGCGAGAGGCGGATTGTGCGCTTTTTTGCTTCTCAAACGCCTCTCGCGAGTGCAGTTCGCGCCCGCGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22726
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098594 Nonsense 734 960 15 20
Genomic Location (Zv9):
Chromosome 15 (position 43693512)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 3181964
GRCz11 14 3154485
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATTTTAACGTTCTCCAGATTCTTCGTCGGAGTGTCAGGAGGACTCGTG[G/A]CCGCTGGACATGGATGATTTACTCAGATTCTCCTCTCAGGTGGCGCAGGG
Long Flanking Sequence:
TATGCTGAAGTTTTATCTTTGGGTAGAGACTCGGTAATATTTATCTGCAGTGTGACTTCAATCGACCGACGGCATGTTTGTGTGTGTGGGTTTCTGTGTTAGAGGGCGGGGCCACAGGTTTCAAATCTCCTGGGTTCGCGCGTGCATGTGAATCACTTCAAATAACTCGTTATCAAGACGACTCGTCTGAAGCACTATGAGTCGACTCTTTTATAGCTGAATCAACAGTTTTAAACACTGTACTCTTACAGATTGAAGCCTTAGCTGGATATCTTACTTCACTTAGAGCTGTGTTACACACTACATGGAAGGGCATTTTCAAAAACCCATAATATGGGCTCTTTAAAGTGCATTGGTCTTATTTATCCAGAGAAACTGGTTTTATTTTATAGTGCGTTGGTCATATTTTCCATAGCTGTATACAAACACACAGCACACGTTATCAATTTTATATTTTAACGTTCTCCAGATTCTTCGTCGGAGTGTCAGGAGGACTCGTG[G/A]CCGCTGGACATGGATGATTTACTCAGATTCTCCTCTCAGGTGGCGCAGGGACTGGACTTCCTCGCTGCTAAAAATGTGAGTCTCTGAAATAAAAGCAACAGCTTTACGGCCGAGTGAGGGAAGTTACATGATGCTGATCAGTGTTACTGATGGACTGACTGTGCTGAATCTGCAGTGCATCCACCGAGACGTGGCGGCCAGAAACGTTCTGCTCACCAACAGCCGAGTGGCCAAAATCTGTGACTTCGGACTGGCTCGAGACATCATGAACGACTCCAACTACGTAGTCAAAGGAAACGTGAGGAAACTAACACCACATTAATATTCATATTAACCTTAGTCTTTACGTAAGAGAGGGCGCTGCCATTGCAACCTTCCCTTTGATCAGATAGTCCGATTTACGCACTTCTACATGATTGTTGTCCAACTGTTATCCACCTCTGATTTTGAGAATATTTTACAGTTTTGTTGTAAGGAATAGTTATGGATTACATTTTCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28543
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098594 Nonsense 852 960 18 20
Genomic Location (Zv9):
Chromosome 15 (position 43696998)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 3178478
GRCz11 14 3150999
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCAGGAAAGAGTCCGTATCCAAACATCCTGGTGGACTCAAAGTTTTA[C/A]AAAATGATCAAGTGTGGCTATCAGATGTCCAGACCTGACTTCGCTCCTCC
Long Flanking Sequence:
CGCCTGATTTTTCACCACACTTTTAGATTTTACCACATTCTCTCATTATTCTCATTATTTACTACTTTATTTAATTTCGTGGCTTCTGTTTTTGTTTTACCTGCTTTCTGGAACCATTCTTCACCAGATTCGAACACCATTGTCATGGTCAACTCCGCTCTGCATCTCAAGTCCACCGACGTACGCGGCAGGCCACTGGACTAACTTGTAACAGTGGGAAAGCCGTCCTCATGGACATAATCCGTTAGCTGCTAAACACGAAAAGCAACGACGTCATACCGCCCCGTAGCATTAGTTTTTAAGACGGAATGCAGCCATAAGTACCTCTGGCTCCATAATTCACGATCTCCAAAAATGTATACGGGGCTACGTTTTCAGAATGAGCCTCTGTTTGATTCTCTGTGCTTTTGCTTTGAACATGATGAACATCAAATATCTAAAACGTATGTTTCTGCAGGAAAGAGTCCGTATCCAAACATCCTGGTGGACTCAAAGTTTTA[C/A]AAAATGATCAAGTGTGGCTATCAGATGTCCAGACCTGACTTCGCTCCTCCAGAGATGTAAGGAATCTTTATTAGGAATATTTACCACCATTTAAAATGATAGCGATAATAATACAATACAATGCAAATTTGTAGCAATGTCAAATATCTAACAACAATGTGCATTATTAGTCATTCATTTTCCTTCGGCTTAGTCCCTTATTTATCAGGGGTTGCAACAGCAGAATGAACCGCCAACTATTCCAGCATATGTTTTACGTAGCAGATCCCCTTCCAGCCGCAAGCCAGTACTATGAAACACCCATACACTGTCACATTCACACACACACACACTCATACACTACGGCCAATTTAGCCTACCCAATTCACCTATAGCGCCTGTGTTTGGACTGTGGAGGAAAGCAGAGCACCTGGAGGAAACACATGCAAACATGGGGAGAACATGCAAACACAGTGCTAACCACTGAGCCAAACGTTTGCTTACCAACACACAAAATACTG
Associated Phenotype:
Not determined