Busch Lab

ZMP

fancl

Ensembl ID:
ENSDARG00000007885
ZFIN ID:
ZDB-GENE-040426-1045
Description:
E3 ubiquitin-protein ligase FANCL [Source:RefSeq peptide;Acc:NP_998147]
Human Orthologue:
FANCL
Human Description:
Fanconi anemia, complementation group L [Source:HGNC Symbol;Acc:20748]
Mouse Orthologue:
Fancl
Mouse Description:
Fanconi anemia, complementation group L Gene [Source:MGI Symbol;Acc:MGI:1914280]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35494 Essential Splice Site Available for shipment Available now
sa35495 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa9453 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35494
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020946 Essential Splice Site 121 371 None 14

The following transcripts of ENSDARG00000007885 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 26930451)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 26576111
GRCz11 13 26706561
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTATTATTCGCAGCTGATAACAGAGATGGAGATCTTGGGATGGGATAAG[T/A]ATGTTCTCCGAGGTTCACGTTGCACAATGTTTCCCTCTAATAACATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35495
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020946 Splice Site, Nonsense 154 371 7 14

The following transcripts of ENSDARG00000007885 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 26987312)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 26632972
GRCz11 13 26763422
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAGTATTAAACCATAATTATCTCTCACATTTTTTTCTCTTTGTTCAGTA[T/A]CCAGCTGAGGCTCCAGAGTTTTCTGCGGATCTTCCAATTCCTCTGGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9453
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020946 Nonsense 295 371 11 14

The following transcripts of ENSDARG00000007885 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 26999504)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 26645164
GRCz11 13 26775614
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAATATGAAAGATGTGTTGGAGATTGAATTTCCATCGCCTACCACCCAC[G/T]AAAAATCTGTACGTTGCATATTTTCGTCTCATAGACTGCCACTTACTATT
Associated Phenotype:
Not determined