Busch Lab

ZMP

si:ch211-151f2.1

Ensembl ID:
ENSDARG00000007856
ZFIN ID:
ZDB-GENE-091118-38
Human Orthologue:
RTN4RL1
Human Description:
reticulon 4 receptor-like 1 [Source:HGNC Symbol;Acc:21329]
Mouse Orthologue:
Rtn4rl1
Mouse Description:
reticulon 4 receptor-like 1 Gene [Source:MGI Symbol;Acc:MGI:2661375]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa21781 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18991
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015279 Nonsense 49 355 1 2
Genomic Location (Zv9):
Chromosome 10 (position 37154141)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36009444
GRCz11 10 35953212
KASP Assay ID:
2260-3508.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGCTGCCAGGCTCACAACTTTCAGGTGGTTCCTGAGGGAATTCCGGCC[C/T]AGAGCGAGCGCGTCTTTCTGCAGAACAACAAGATCCAGCGGCTGCTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21781
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015279 Essential Splice Site 152 355 2 2
Genomic Location (Zv9):
Chromosome 10 (position 37159611)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36014914
GRCz11 10 35958682
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTTGCTTTTTCCACACCTGCTAACTAACAGTGTTTATCTTACACTTTC[A/C]GAGCAACCAGCTGGAGTTTCTCGAGGATGACATGTTCATTGATCTACTGA
Associated Phenotype:
Not determined