Busch Lab

ZMP

atp2b1b

Ensembl ID:
ENSDARG00000007788
ZFIN IDs:
ZDB-GENE-080409-1, ZDB-GENE-080409-1
Description:
ATPase, Ca++ transporting, plasma membrane 1b [Source:RefSeq peptide;Acc:NP_001129103]
Human Orthologue:
ATP2B1
Human Description:
ATPase, Ca++ transporting, plasma membrane 1 [Source:HGNC Symbol;Acc:814]
Mouse Orthologue:
Atp2b1
Mouse Description:
ATPase, Ca++ transporting, plasma membrane 1 Gene [Source:MGI Symbol;Acc:MGI:104653]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa31111 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44284 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24661 Nonsense Available for shipment Available now
sa10317 Nonsense Available for shipment Available now
sa30243 Nonsense Mutation detected in F1 DNA Not yet available
sa12324 Nonsense Available for shipment Available now
sa44283 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30244
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045863 None None 350 None 8
ENSDART00000104353 Nonsense 362 1240 7 20
ENSDART00000121977 Nonsense 348 1227 8 21
Genomic Location (Zv9):
Chromosome 25 (position 20115030)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19527007
GRCz11 25 19624958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGCCCCTCAACAGTGATGATGGAACAGAAGAAGAGCAGAAAAAAGCC[A/T]AGATACCAAAGAAAGAAAAATCGGTCCTTCAAGGAAAGCTTACCAAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31111
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045863 None None 350 None 8
ENSDART00000104353 Essential Splice Site 458 1240 9 20
ENSDART00000121977 Essential Splice Site 445 1227 10 21
ENSDART00000045863 None None 350 None 8
ENSDART00000104353 Essential Splice Site 458 1240 9 20
ENSDART00000121977 Essential Splice Site 445 1227 10 21
Genomic Location (Zv9):
Chromosome 25 (position 20114572)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19526549
GRCz11 25 19624500
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAAGACAAATAAGAAGTACTGCAGTAAAATCGTCTGTGTTCTTCTCTGT[A/T]GAAAATGATGAAGGACAATAACCTGGTGAGACATCTGGACGCTTGTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44284
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045863 None None 350 None 8
ENSDART00000104353 Essential Splice Site 458 1240 9 20
ENSDART00000121977 Essential Splice Site 445 1227 10 21
ENSDART00000045863 None None 350 None 8
ENSDART00000104353 Essential Splice Site 458 1240 9 20
ENSDART00000121977 Essential Splice Site 445 1227 10 21
Genomic Location (Zv9):
Chromosome 25 (position 20114572)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19526549
GRCz11 25 19624500
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAAGACAAATAAGAAGTACTGCAGTAAAATCGTCTGTGTTCTTCTCTGT[A/T]GAAAATGATGAAGGACAATAACCTGGTGAGACATCTGGACGCTTGTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24661
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045863 None None 350 None 8
ENSDART00000104353 Nonsense 472 1240 9 20
ENSDART00000121977 Nonsense 459 1227 10 21
Genomic Location (Zv9):
Chromosome 25 (position 20114526)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19526503
GRCz11 25 19624454
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTAGAAAATGATGAAGGACAATAACCTGGTGAGACATCTGGACGCTTG[T/A]GAGACGATGGGCAATGCTACCGCCATTTGCTCGGATAAAACGGGCACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10317
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045863 None None 350 None 8
ENSDART00000104353 Nonsense 634 1240 11 20
ENSDART00000121977 Nonsense 621 1227 12 21
Genomic Location (Zv9):
Chromosome 25 (position 20109715)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19521692
GRCz11 25 19619643
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCCAGATGCTGCAAAATCCTGACAAGCAATGGTGATGCCAAACATTTC[A/T]GACCCACTGATCGAGATGACATGGTGACACAGGTGATAGAGCCTATGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30243
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045863 None None 350 None 8
ENSDART00000104353 Nonsense 725 1240 12 20
ENSDART00000121977 Nonsense 712 1227 13 21
Genomic Location (Zv9):
Chromosome 25 (position 20108575)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19520552
GRCz11 25 19618503
KASP Assay ID:
2261-9631.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCTGGGATCACTGTGCGGATGGTCACAGGGGATAATATTAACACTGCT[C/T]GAGCCATAGCAACAAAGTGTGGCATTCTCCATATCGGGGATGACTTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12324
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045863 None None 350 None 8
ENSDART00000104353 Nonsense 797 1240 14 20
ENSDART00000121977 Nonsense 784 1227 15 21
Genomic Location (Zv9):
Chromosome 25 (position 20107499)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19519476
GRCz11 25 19617427
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATGTTTTTCTTATCTCTTTAAGGTATAATCGATAGCACCGTCTTAGAA[C/T]AGAGACAAGTAGTAGCTGTCACTGGAGATGGAACCAATGATGGTCCTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44283
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045863 None None 350 None 8
ENSDART00000104353 Nonsense 1074 1240 19 20
ENSDART00000121977 Nonsense 1061 1227 20 21
Genomic Location (Zv9):
Chromosome 25 (position 20102883)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19514860
GRCz11 25 19612811
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCACCAAATCCCCTTTGACCCACAGGTGATTTCCACCGTTCCCACAAGA[C/T]GACTGAAGTTCCTGATAACCATGGGTCATGGCACTAAGAAGGAGGAGATC
Associated Phenotype:
Not determined