Busch Lab

ZMP

bltk

Ensembl ID:
ENSDARG00000007783
ZFIN ID:
ZDB-GENE-040724-106
Description:
tyrosine-protein kinase Blk [Source:RefSeq peptide;Acc:NP_001025391]
Human Orthologue:
BLK
Human Description:
B lymphoid tyrosine kinase [Source:HGNC Symbol;Acc:1057]
Mouse Orthologue:
Blk
Mouse Description:
B lymphoid kinase Gene [Source:MGI Symbol;Acc:MGI:88169]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa29333 Nonsense Mutation detected in F1 DNA Not yet available
sa23669 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5670
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020099 Nonsense 271 485 8 12
ENSDART00000138028 Nonsense 271 485 11 15
Genomic Location (Zv9):
Chromosome 20 (position 19266217)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19294474
GRCz11 20 19194057
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ARGGCACGATGGAGCCTGAAGCCTTCCTGCAGGAGGCCAATCTGATGAAG[C/T]AGCTCCAGCATGAGAGACTGGTCAAACTGCAYGCTGTCGTCACCAGAGAG
Long Flanking Sequence:
AGGCTGTTTGCCAGATGTGTAAAAAAGAGTTAAATGTTCTTTGTAAACAATGACAATTTGTTTCTAAATGTATTTTGTGTAGTATGTTTGTGTATTTATACTTTCTGAAAGTAGAAACAAAAGAAAATTATTCAAAGATGATTACAGAATAAAAGATTCTGTGAAGGAATTCTTGATTTCTTATTAATCTAAACATATGGCCAAAATAATCAGTCATAAAAAAACTAAATATACATAGTTTTTATGACATAAGTTGCAGCAATCTCTGACCTAATTTCCTTTATATACAGTATATTTATACACACAAACAGTAAATAGAATCTTTATATTTACAGTAGGCGGTTCATTCCGCTGTGGCGAATACTTACAGTAACAAGCCTGTGTGTCTGTTGCTCTTGTATTTAGGGTTCTACAAAAACAACCAAAAAGTTGCCATCAAGACTTTAAAGGAAGGCACGATGGAGCCTGAAGCCTTCCTGCAGGAGGCCAATCTGATGAAG[C/T]AGCTCCAGCATGAGAGACTGGTCAAACTGCACGCTGTCGTCACCAGAGAGCCCATTTATATTGTCACTGAGTACATGGCTAATGGTTAGAACCATATTATTATATTTAATAAAACACGTGTGTTTTTAAATTATGTGGCAAATGTCTAAATGATGCAATTGTCCTTTTTCTTTTTAAGGAAGCCTGTTAGACTTTCTGAAGACAGACGATGGCCATAAATTAAAACTTTCCAAGCTGATTGATATGACTGCTCAAGTAAGAATCATTTATTTATTTTGTTTTAATTTCTTTTGATTGCCTTCGTTACTTAGCAGCACTTAAATATTTCTGTGGCCCTGCAGATTTGAAACAAAAACACTTGAACATTGTGCACATTGATGATTTGTGTTTAATAGTATGCATTTGTGCACATTCATGCAACTTTTGTAACTATTTTAGGAACTGCTTTGCATCAAAACTATTCAGAGATGAGAAGAGGAAATGGCCTTTTTGGTTTTGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29332
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020099 Essential Splice Site 324 485 9 12
ENSDART00000138028 Essential Splice Site 324 485 12 15
Genomic Location (Zv9):
Chromosome 20 (position 19266474)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19294731
GRCz11 20 19194314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGATGGCCATAAATTAAAACTTTCCAAGCTGATTGATATGACTGCTCAAG[T/C]AAGAATCATTTATTTATTTTGTTTTAATTTCTTTTGATTGCCTTCGTTAC
Long Flanking Sequence:
AGCAATCTCTGACCTAATTTCCTTTATATACAGTATATTTATACACACAAACAGTAAATAGAATCTTTATATTTACAGTAGGCGGTTCATTCCGCTGTGGCGAATACTTACAGTAACAAGCCTGTGTGTCTGTTGCTCTTGTATTTAGGGTTCTACAAAAACAACCAAAAAGTTGCCATCAAGACTTTAAAGGAAGGCACGATGGAGCCTGAAGCCTTCCTGCAGGAGGCCAATCTGATGAAGCAGCTCCAGCATGAGAGACTGGTCAAACTGCACGCTGTCGTCACCAGAGAGCCCATTTATATTGTCACTGAGTACATGGCTAATGGTTAGAACCATATTATTATATTTAATAAAACACGTGTGTTTTTAAATTATGTGGCAAATGTCTAAATGATGCAATTGTCCTTTTTCTTTTTAAGGAAGCCTGTTAGACTTTCTGAAGACAGACGATGGCCATAAATTAAAACTTTCCAAGCTGATTGATATGACTGCTCAAG[T/C]AAGAATCATTTATTTATTTTGTTTTAATTTCTTTTGATTGCCTTCGTTACTTAGCAGCACTTAAATATTTCTGTGGCCCTGCAGATTTGAAACAAAAACACTTGAACATTGTGCACATTGATGATTTGTGTTTAATAGTATGCATTTGTGCACATTCATGCAACTTTTGTAACTATTTTAGGAACTGCTTTGCATCAAAACTATTCAGAGATGAGAAGAGGAAATGGCCTTTTTGGTTTTGTAAGCTCATGGTCTGAGCATTTAGTAGAGCTGAACACTTTTAAGATCCACCACAAATTCAGATTAATATCTTCCGGGCAGGATATTGCGTAGATTTTTCCATCGCACTGAAGCCCCAACTGTGCATGACTGTGATCTTGGTCTCTGTATGCAACACACAGCTTCCTGTTAGAGCCCACTGTTGATGCTGTCTGATATTTATAGTCTGCAATGCAAATGTACTGTACACAAAATACAGTTGAAGTCAGAATTATTAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29333
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020099 Nonsense 381 485 11 12
ENSDART00000138028 Nonsense 381 485 14 15
Genomic Location (Zv9):
Chromosome 20 (position 19267632)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19295889
GRCz11 20 19195472
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCCTATCATTGCATCTTGTTTTATTGATCAGGTGCAAAGTTCCCTATT[A/T]AGTGGACGGCTCCTGAAGCCATCAACTACGGTACTTTCACCATCAAGTCA
Long Flanking Sequence:
ATGGCTTACATCGAGAGAAAAAACTACATTCACAGAGACCTGCGTGCCGCTAATATTCTCGTCTCAGAGACCCTGCACTGTAAAATAGCTGACTTTGGTCTTGCCAGGATCATAGAAACAGAATACACTGCACAAGAGGGTGAGTACACCAATGTATTTAGCTACTTTTTTACACTACCACAAATTAACAAGCACCAGTCAGTTCTGACATTTGGTTTCTAATGCAATGCACAGACATATCTGATTTTTAAAGTTTGATACGAGCTGCTGATATTCAAAAACGCCACCTTCTATCTGCGTTGAACTTTCCGTGGTGACTTTTTTTCCACTTTACAGCGTGATTGCATGATCACTCTGGCTTTATTTATAGTAATTTCAGTAACTGATTCAATCAAATTATAAATGTATTTTCCATGCATGCTTACAGTATATGTTCCACACCACTATTCATGGCCTATCATTGCATCTTGTTTTATTGATCAGGTGCAAAGTTCCCTATT[A/T]AGTGGACGGCTCCTGAAGCCATCAACTACGGTACTTTCACCATCAAGTCAGACGTGTGGTCCTTCGGAATTCTTTTAACAGAGATTGTCACATATGGCCGAGTACCGTATCCAGGTAATACGTTTTTCCTCACTTGGGTTTTGGCTTCCACTCACAGCTGTGTTGTGTAGGAGAGATGAGTAGATCTTGAGCAACCAGGTTGGGATTTTCTTCACAATTTCAGGCATGACGAATCCGGAGGTGATCCGTAACCTTGACAGGAACTATAGGATGCCGTGTCCAGACGCATGTCCAGGAGAGCTCTATGACATCATGACAAAGTGTTGGATGGAAAAGCCAGAGGACAGGCCTACTTTTGAATATCTGCAGGACACACTCAATGACTTCTTCATTGCTACTGAAGGCCAGTATGAGATGCAGCCATAACCTCCATGTGGAAACTGTATGAACTGTAATAAGGATGTACAAAACACAGAATGGACTAAATCCACACCAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23669
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020099 Nonsense 441 485 12 12
ENSDART00000138028 Nonsense 441 485 15 15
Genomic Location (Zv9):
Chromosome 20 (position 19267923)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19296180
GRCz11 20 19195763
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGATCCGTAACCTTGACAGGAACTATAGGATGCCGTGTCCAGACGCATG[T/A]CCAGGAGAGCTCTATGACATCATGACAAAGTGTTGGATGGAAAAGCCAGA
Long Flanking Sequence:
TATCTGCGTTGAACTTTCCGTGGTGACTTTTTTTCCACTTTACAGCGTGATTGCATGATCACTCTGGCTTTATTTATAGTAATTTCAGTAACTGATTCAATCAAATTATAAATGTATTTTCCATGCATGCTTACAGTATATGTTCCACACCACTATTCATGGCCTATCATTGCATCTTGTTTTATTGATCAGGTGCAAAGTTCCCTATTAAGTGGACGGCTCCTGAAGCCATCAACTACGGTACTTTCACCATCAAGTCAGACGTGTGGTCCTTCGGAATTCTTTTAACAGAGATTGTCACATATGGCCGAGTACCGTATCCAGGTAATACGTTTTTCCTCACTTGGGTTTTGGCTTCCACTCACAGCTGTGTTGTGTAGGAGAGATGAGTAGATCTTGAGCAACCAGGTTGGGATTTTCTTCACAATTTCAGGCATGACGAATCCGGAGGTGATCCGTAACCTTGACAGGAACTATAGGATGCCGTGTCCAGACGCATG[T/A]CCAGGAGAGCTCTATGACATCATGACAAAGTGTTGGATGGAAAAGCCAGAGGACAGGCCTACTTTTGAATATCTGCAGGACACACTCAATGACTTCTTCATTGCTACTGAAGGCCAGTATGAGATGCAGCCATAACCTCCATGTGGAAACTGTATGAACTGTAATAAGGATGTACAAAACACAGAATGGACTAAATCCACACCAAAATGGATTATGGGGAATATACTGTAGCAAGAAAACTGCCTCCTTGTATATTAGTAAATATTTTATTTGGCACATTTTCACAGTTCCATCTATTTCTACGTTGTTCTTTTTACATTTGTTTCATTGTTCTTTCAAGTCTGTATTGTTTTCAATAAAATATTTAAGTTAGTCCATATTGTCAGTTAGTCTTGTTTGGCCAGACATTCAGATTGATGGCAGAAGGTTTAGACTCAATCACAGCTTTCAGTGGCTATGTTTCCATCCACCTATTTTTATGTGCATTTTGTACATGCGCA
Associated Phenotype:
Not determined