Busch Lab

ZMP

lgsn

Ensembl ID:
ENSDARG00000007715
ZFIN ID:
ZDB-GENE-060312-26
Description:
lengsin [Source:RefSeq peptide;Acc:NP_001026844]
Human Orthologue:
LGSN
Human Description:
lengsin, lens protein with glutamine synthetase domain [Source:HGNC Symbol;Acc:21016]
Mouse Orthologue:
Lgsn
Mouse Description:
lengsin, lens protein with glutamine synthetase domain Gene [Source:MGI Symbol;Acc:MGI:2672844]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa27737 Nonsense Mutation detected in F1 DNA Not yet available
sa21859 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27737
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020256 Nonsense 127 668 2 4
Genomic Location (Zv9):
Chromosome 11 (position 11387550)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11282553
GRCz11 11 11266174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTGAGGGTGGCGTTCCCAAACAAACCATGGATGAACTGAAAAGTGTGT[T/A]GCGTGAGAGTTCCCTACTGAGTGCAAAAGGACAAGATGAAGGACGAAGCT
Long Flanking Sequence:
GTTTTTATGTTTTGTTTTGTTTTTTCATTTGTTAAATGCATTTGATACTTTGGTGTTGTGTTAATGTCTTAATTTTGAATTAATCCAGTACTTTCTGTTATGTATTGCCAGTCATATATAGTGATAAAATCCTAAATTTTGTCCTCTTCAGGAGACAGTTCCAGACCAGGTGGATGGAGGAAGTATGAGTGCAAGAAAGAAGGATGCAGATCCAAGAGAGAAGCGTCTTTCCTCCTCTGAATGGGACAGGAAAGGAACACCTGTAGCCATATCGCAATCAAAAGTACCAATTTCTGGCCCCACAAATGATCCCATCCTCATTTCCATTGGCCCTCCACATCATTTCCCTTCTGTTTCCAGTGAGTCCCAGTACCAGGGTTTCTCTCGAGAGGAAGATTACATCAACAGGCATGGATGGAGAAGGGAGAATGTGCAGTATTACCCGTCAAATACTGAGGGTGGCGTTCCCAAACAAACCATGGATGAACTGAAAAGTGTGT[T/A]GCGTGAGAGTTCCCTACTGAGTGCAAAAGGACAAGATGAAGGACGAAGCTACCCTCCGGGTCAAAGAGTGGACTGTAAGCCAGACCAGGAACCATCCAGGACTTTCAGCACCTTCAAGCCCTATTCAGAAGCTAGGAGGGCATCCAGACAAAGAGACAGAAACTGGGATTCTAGTGGGTCTTCGAGGACTGATGGACCTCCAAATAGGTCCTCTGGTATGAATTCCCCAACTTTTCAGGCATCCGATTGGGGTGAGGTTGGCACATCCCAGTCAGGTCAGTATTTAATTCTTTATTCTTGAAGTCCATGTGAAATCAAAATTCACTGTTTATTTTGCTAGTGCACATTGATAGTCTTAAAGTCAACAATTAATCAGTTTAGGTTAATCCATTGGAAAAAAAAACTGTTTTGGTAAAAGATTTAATCAAAGTTTTAACTATTTGCTTCTGATCTGAACCAGCAAACCTTCCCTGATGACTTCAGTGTAACTGGTAGGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21859
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020256 Nonsense 477 668 4 4
Genomic Location (Zv9):
Chromosome 11 (position 11385541)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11280544
GRCz11 11 11264165
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACTACATTGCCACCTTTTTCACCTACGAGAACATCCAGAATTCAGGTT[T/A]ACTCTCCCATAGCCTCTGGGATGCAAGTGGCAGAAGAAGCCTTTTTCATT
Long Flanking Sequence:
CGTCCTGCTGGTCCCAGATCTCTCCACATTCCAAATTCTTCCCTGGGCGGATCAGACCGCTCGTCTCATCTGTGACCCCTGCACAATCACAGGAGTGCCTCTACGAACATCGCCCCGTCTCATAGCCAAGATGATGCTCGGACAGCTCCAGAGCATGGGATTCTCTCTGCACTCATCGTTTACCTACGAGTGCTGTATCTTCGGGAGCCCTGAACATGTGGGACCCAAAGCAGTGTTCTTCCCTGCAACCACACTGTTAAGCAACAACGATCAACCCTTCCTCCAGCAGTTAGTCAAAGGCATGTACAACATGGGAGTGGATGTTGAGAGCTTCTCTTCAGCAAATGGACCAGGACAGATGGAAATTTGCTTCAAGCCCAGGTTTGGAATGGATGCCGCTGACAACGCCTATACCTTTCGCACCGGAATCAAAGAGATGGCCAGGAAGTATGACTACATTGCCACCTTTTTCACCTACGAGAACATCCAGAATTCAGGTT[T/A]ACTCTCCCATAGCCTCTGGGATGCAAGTGGCAGAAGAAGCCTTTTTCATTCAGGCAATGGGGAACTTTCGGAGATTGGCAGAAAATGGCTCTCAGGTCTTCTCCATCATTCTGCCGCTTTGAGCTGCCTCTTGGCTCCAGGAATCAGTTGTCGAACCCAGATTTCCAAAGGCAAGAAAGATTCCAAGAACCATGTTTATGCCACATGTGGCTGCAATGACAACAGCTGCGACTTTAATGTGAAGATTCATGGTGGACGGGAGACACACATTGATAACAAGCTGGCTTCAGCAATGGCAAACCCTTACATTGTGTTGGCAGCCACTATAGCAGCAGGACTGGACGGAATCAAGCGTAATCTCAATGCAGAACAGGTACTAAGCAGAGCTCCAAATCAGCAGAAACAGTTTGTCATCCCTGTTAAACTGGATGATGCTTTATTAGCTCTGGCAGAGGACAGTGTGATTTGTGGTGCACTGGGAGAGCCTTTCGTGCAGTATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3788
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020256 Nonsense 594 668 4 4
Genomic Location (Zv9):
Chromosome 11 (position 11385191)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11280194
GRCz11 11 11263815
KASP Assay ID:
2260-3988.1 (used for ordering genotyping assays)
KASP Sequence:
ACCCTTAYATTGTGTTGGCAGCCACTATAGCAGCAGGACTGGACGGARTC[A/T]AGCGTAATCTCAATGCAGAACAGGTACTAAGCAGAGCTCCAAATCAGCAG
Long Flanking Sequence:
CAGGACAGATGGAAATTTGCTTCAAGCCCAGGTTTGGAATGGATGCCGCTGACAACGCCTATACCTTTCGCACCGGAATCAAAGAGATGGCCAGGAAGTATGACTACATTGCCACCTTTTTCACCTACGAGAACATCCAGAATTCAGGTTTACTCTCCCATAGCCTCTGGGATGCAAGTGGCAGAAGAAGCCTTTTTCATTCAGGCAATGGGGAACTTTCGGAGATTGGCAGAAAATGGCTCTCAGGTCTTCTCCATCATTCTGCCGCTTTGAGCTGCCTCTTGGCTCCAGGAATCAGTTGTCGAACCCAGATTTCCAAAGGCAAGAAAGATTCCAAGAACCATGTTTATGCCACATGTGGCTGCAATGACAACAGCTGCGACTTTAATGTGAAGATTCATGGTGGACGGGAGACACACATTGATAACAAGCTGGCTTCAGCAATGGCAAACCCTTACATTGTGTTGGCAGCCACTATAGCAGCAGGACTGGACGGAATC[A/T]AGCGTAATCTCAATGCAGAACAGGTACTAAGCAGAGCTCCAAATCAGCAGAAACAGTTTGTCATCCCTGTTAAACTGGATGATGCTTTATTAGCTCTGGCAGAGGACAGTGTGATTTGTGGTGCACTGGGAGAGCCTTTCGTGCAGTATTTTATCGCCATGAAGCAAATAGAGATGGAGAGCCAAGAGGATGCTGACAGAAATGAGGGACTTGATTATTTCATTTAACTTGTGACTTTGGCATTTTTTGTGTATTCAAAACCCAGAAAACTAATTTGATGACTATTTGATTTGTTACTGAAGACAAATAATCCCTCTTTTGCAAGATTTGTAATTAAAATCATACAACTGACTGGTATCTGCTACACACTGTCTGACTGATTTTTTTGTTCTGCTCCAGTACTTTGGGACAAATTAGAGCTAAGTCCTGCAAGATGTTGCACAAAACATGTTCAACAAACTCTGGGTTGCAGGGTAAGTTTTGGGTTGACAAATCCAAAA
Associated Phenotype:
Not determined