Busch Lab

ZMP

crybb1l1

Ensembl ID:
ENSDARG00000007576
ZFIN ID:
ZDB-GENE-100112-3
Description:
LOC553473 protein [Source:UniProtKB/TrEMBL;Acc:Q502C7]
Human Orthologue:
CRYBB1
Human Description:
crystallin, beta B1 [Source:HGNC Symbol;Acc:2397]
Mouse Orthologue:
Crybb1
Mouse Description:
crystallin, beta B1 Gene [Source:MGI Symbol;Acc:MGI:104992]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa16591 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16591
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074097 Nonsense 26 237 3 7
ENSDART00000123832 Nonsense 8 220 2 6
Genomic Location (Zv9):
Chromosome 14 (position 49245232)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47322891
GRCz11 14 46310183
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YCTCTATTCTGATTGGCCCCMMAGGCATCATGTCTTCCAGTGGAGAAAAA[A/T]AGACCGCCTCCCAGACCGACGGCAAGGGAGCCCCCAGCAAGAAGTCCGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2761
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074097 Nonsense 166 237 6 7
ENSDART00000123832 Nonsense 149 220 5 6
Genomic Location (Zv9):
Chromosome 14 (position 49241848)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47319507
GRCz11 14 46306799
KASP Assay ID:
554-3089.1 (used for ordering genotyping assays)
KASP Sequence:
GGCCGCAAGATGGAGATCATGGMTGACGACGTTCCCAGTCTGTTCTCTTA[C/A]GGATTCACAGATAGAGTCGGCAGCATCATGGTCAGCTGTGGAACGTAAGT
Associated Phenotype:
Not determined