Busch Lab

ZMP

sema3bl

Ensembl ID:
ENSDARG00000007560
ZFIN ID:
ZDB-GENE-030131-2956
Description:
semaphorin-3G [Source:RefSeq peptide;Acc:NP_001116184]
Human Orthologue:
SEMA3G
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G [Source:HGNC
Mouse Orthologue:
Sema3g
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G Gene [Source:

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa34420 Nonsense Available for shipment Available now
sa21309 Nonsense Available for shipment Available now
sa15484 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34420
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010393 None None 204 None 7
ENSDART00000046863 Nonsense 72 771 2 15
ENSDART00000140980 None None 182 None 5
Genomic Location (Zv9):
Chromosome 8 (position 27392482)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26520400
GRCz11 8 26539539
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGATGAATATCATGACAGGCTTTTCCTGGGAGGGAAGGATGTTCTCTA[C/A]TCACTCAGACTGGATCACACGCATGATGCTAAAGAGGTAACACAGACACA
Long Flanking Sequence:
TAGCAAGGTCTTCATCAAGTCACCTCGCCAAGTTTAGTTAAAATACCTCTACTACAAAATAGTGCTGACATAACCTTCCTATCCACTGTGTTTTAACCCAAGCTTTGAACAAACAGTCACGCCAATAAAGTGCAATTAAATTTAACTGACAAGAAGAGAAACAGAGTGGTTTGTTTTTTTTAGAGAACGCCATCAGTCACGTCCCTGCTGTTCTGGATTTAAGTTGATCGTCCTCTTTATGCATCATGGTTTTCTCCTCATAAAGTTAATCATCTTTGACTAGCAGAGACAGATTTATTGTCATTTTTCAGCTGAAATCTTGTACTTATTGTCATGTCATTCATAATTCACCTTTTTTCTCTTTCTCCCTTTGCCACAGATCTTCTGGACACAAATCGTACCTCAGTTTTCAACGGGTTACACGGAGATCTGCACTTGTCGGCTGTGTTTTTGGATGAATATCATGACAGGCTTTTCCTGGGAGGGAAGGATGTTCTCTA[C/A]TCACTCAGACTGGATCACACGCATGATGCTAAAGAGGTAACACAGACACACTATCATTGAGGTAAGGTGAAGATTATAGGCTGTCATAAAAGTCTGTTAGTGAGATGTGTCATGAATTTCATTCTGTACTACTGGAGACTGTTATCTACACACACAGATAAAATCAGCAGACGCCTATTTGTGCTGACATATTTTACCCATGATTAGTAAGTAATCTTTGAAGACTGGTTTACAAATGACACATGCTTACTTTTGAAAAACTAGATGAAGAGGAATGGAACAAGAAGAGATTTTTGAAAAGCTGAATTGTTGGAATTAAAATAATTCTCATGGTGATTTGAAAAAAAAACTTCAAAATGCATCCTTCTAGTCAAGAGTCTCTATAAATGTTGGTTTAAATGGAAAAATGATTGCAGGGGCAATAATGTAAAAGGAAGTTTACCTTACAGTATGTAAGTTCTACCAGAAAGACATAATAAATTTATTTGATGCGTATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21309
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010393 None None 204 None 7
ENSDART00000046863 Nonsense 291 771 8 15
ENSDART00000140980 None None 182 None 5
Genomic Location (Zv9):
Chromosome 8 (position 27417428)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26545346
GRCz11 8 26564485
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAATAAGTGGAGCACATTTATTAAAGCCCGACTGGTGTGTTCAGTTCCT[G/T]GACCTCACGGCATCCAAACACACTTTCATCAGCTAGGTGAGACCAGAAAC
Long Flanking Sequence:
CTTATTCATTGTTGCTCTTATAGTTGTGTAAATTGCTTCCTTGTCCTCAATTGTAAGTCGCTTTGGATAAAAGCGTCTACTAAATGACAATATAAATGTCAATAAAAGCCCAAGGTAAATGTTTAAGGGTTCATATAGTCTTGTTTTTCAACTCTAAACAATGACCTGTTCACTATTGTATCACTTGTGGACAAAATAAGTAGTGCTTCTTTATAATGAAATTTTTGTTGCATGCACTATACACTTAAAACCGAAGTGTAGCCCCAAAATCTGAATTATTTCAGAAATAGGATGGGTAGAATATAGACTGAGATGCAGGCATGGTTTGATTTACACACAGTGGTCTTTGGAGTATATGATTCTGGGATTTGCTAATCTGTTAAGTGTAGAAGTGAAATGACTTACTGTTTTTGTGCTTTCAGAATGATGTGGGCGGACAGAGGGTTTTGGTGAATAAGTGGAGCACATTTATTAAAGCCCGACTGGTGTGTTCAGTTCCT[G/T]GACCTCACGGCATCCAAACACACTTTCATCAGCTAGGTGAGACCAGAAACACACACATACCGTCAGCAATTTGTATGCATTACTAAATAGACCTGACATCATTTTAATCTCTTGCATTGCTTTTGAGAAATTTGATTGTATGTGTTTATCATGCAGAGGATGTGTTTCTATTAAGAACAAAAGATGAAACCAATCCAGAGATCTACGCAATATTCAGCACAATCAGGTCTGTAGCAGAACTAGACTGAAAAATGTTTGTCTGTGTATTTCATCTGTACAGCTCTGTACTTTACTTTAGAATTGACTTAATTCTGTCTTTGTAAAACATTTTTTATTTTGGTAACATTTAGAATAATCTTTTATTTATCTTCACATTTACTTTTTCCTGTTTGAATCCATTCATTTTTTTTGTTTTCCTTATACATGCCATTTTCTTTTCCTATTAGTGTAAGTTATAAGTTAAAATATATATAATATATATATTATATTATAATAACATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8318
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010393 Nonsense 130 204 5 7
ENSDART00000046863 Nonsense 584 771 14 15
ENSDART00000140980 Nonsense 132 182 4 5
Genomic Location (Zv9):
Chromosome 8 (position 27424145)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26552063
GRCz11 8 26571202
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCTCTGTTCAGTGGAGGATGTGGATSTGAGTGAAGAACGKGTTGTTTA[C/A]GGCACTGAGAACAACAGCACCTTCCTGGAGTGCGTCCCTCGGTCGCCGCA
Long Flanking Sequence:
ACACACCTATTATTCAGCTAAAGTAGGCTATGACGAACCACAAAACTTTTTTGAGTGGAAACATTCTACTTTTGTTGTGCTTGTGATGGAGATTCTGGATGATCCACTAGTTTTTCCAGTGTTTCACCATTGGAAAAGCTTAAATGTATGCAGGTAAATCCTCTCTCAGTTATTTCTACTGTATATACAGTATTTATGAGGGCTGAGCTAAGGAAGCCTCCAGACCAGATAAAGTAATGGCCATTTTGTTTCAAATACATATTGTCAGCAGTAGACCAATCTCAAGAGATTATCATATGACCAATCAAAGCAAACCAGGATCTCAGAAAGGATGTTTTACATCTCAAACAAATCACTTCAGATTTTTACACCCCCGATGTTAACCTATTGTAGAAAAAGGTAAAATAACACAACAAGGCAGTTTAAAGAGTCTGTATTAAGAGTAAAGTGTTTCTCTGTTCAGTGGAGGATGTGGATCTGAGTGAAGAACGGGTTGTTTA[C/A]GGCACTGAGAACAACAGCACCTTCCTGGAGTGCGTCCCTCGGTCGCCGCAGGCCACTGTCACATGGCACATTCAGAGAGATGACTACTTAGGGGAGGTGAGAGACTAAAGCAGGTCGCACACCAGAAGCGCCGCGCAGCGCCACGCAGCGCCATGCATTTTAGAATTCTAAACAAGGGTTTCTATCAGGATACACACACCCGCGCCGCAAGTCGGCGGCGCCCGACCACAGCTCAGGACGCAGTTCATTTTTCAGCCGCGCCACAGAGCGCCATCTGATTAGTTTCATGTTAAATATCATTCGAAGGTGCGCGTCTGGTGTGTGATACTTTAAACTGTCATGTGCGCGCCGTGTCGCGGCGCCGAGCGGCACTTCTGGTGTGCAACCTGCTATACTGTACAATACAACAAAATGACATTTAATATTTAAAATGACACTGAAAATATCATGACTTATATTTCAGTGTCATTGCATTCAATGAGGGGTTTGTAGATATTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15484
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010393 None None 204 None 7
ENSDART00000046863 Essential Splice Site 616 771 14 15
ENSDART00000140980 Essential Splice Site 164 182 4 5
Genomic Location (Zv9):
Chromosome 8 (position 27424243)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26552161
GRCz11 8 26571300
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAGGCCACTGTCACATGGCACATTCAGAGAGATGACTAYTTAGGGGAGG[T/C]GAGAGACTAAAGCAGGTCSCACACCAGAAGCGCCGCNNNNNNNNNGCAGCGCCACGCAG
Long Flanking Sequence:
ATGATCCACTAGTTTTTCCAGTGTTTCACCATTGGAAAAGCTTAAATGTATGCAGGTAAATCCTCTCTCAGTTATTTCTACTGTATATACAGTATTTATGAGGGCTGAGCTAAGGAAGCCTCCAGACCAGATAAAGTAATGGCCATTTTGTTTCAAATACATATTGTCAGCAGTAGACCAATCTCAAGAGATTATCATATGACCAATCAAAGCAAACCAGGATCTCAGAAAGGATGTTTTACATCTCAAACAAATCACTTCAGATTTTTACACCCCCGATGTTAACCTATTGTAGAAAAAGGTAAAATAACACAACAAGGCAGTTTAAAGAGTCTGTATTAAGAGTAAAGTGTTTCTCTGTTCAGTGGAGGATGTGGATCTGAGTGAAGAACGGGTTGTTTACGGCACTGAGAACAACAGCACCTTCCTGGAGTGCGTCCCTCGGTCGCCGCAGGCCACTGTCACATGGCACATTCAGAGAGATGACTACTTAGGGGAGG[T/C]GAGAGACTAAAGCAGGTCGCACACCAGAAGCGCCGCGCAGCGCCACGCAGCGCCATGCATTTTAGAATTCTAAACAAGGGTTTCTATCAGGATACACACACCCGCGCCGCAAGTCGGCGGCGCCCGACCACAGCTCAGGACGCAGTTCATTTTTCAGCCGCGCCACAGAGCGCCATCTGATTAGTTTCATGTTAAATATCATTCGAAGGTGCGCGTCTGGTGTGTGATACTTTAAACTGTCATGTGCGCGCCGTGTCGCGGCGCCGAGCGGCACTTCTGGTGTGCAACCTGCTATACTGTACAATACAACAAAATGACATTTAATATTTAAAATGACACTGAAAATATCATGACTTATATTTCAGTGTCATTGCATTCAATGAGGGGTTTGTAGATATTTTCATGCCGGGGATCTCAATGGTTCTTTATGTTTTTATTAAGTACTTTATGTTTTTTACACCACAGTCTTTATGCATCTCTGAAACAAGAAACAAATTTAT
Associated Phenotype:
Not determined