Busch Lab

ZMP

pdxdc1

Ensembl ID:
ENSDARG00000007549
ZFIN ID:
ZDB-GENE-040912-16
Description:
Pyridoxal-dependent decarboxylase domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q66HY
Human Orthologue:
PDXDC1
Human Description:
pyridoxal-dependent decarboxylase domain containing 1 [Source:HGNC Symbol;Acc:28995]
Mouse Orthologue:
Pdxdc1
Mouse Description:
pyridoxal-dependent decarboxylase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1920909]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40115 Nonsense Mutation detected in F1 DNA Not yet available
sa33245 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40115
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027092 Nonsense 515 751 18 23
ENSDART00000144696 Nonsense 530 766 18 23

The following transcripts of ENSDARG00000007549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 36551746)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36497358
GRCz11 3 36639216
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAAATCAGGTTTGAGCCCAGAACCACAGACCTGGATGAAGACAAAAGA[C/T]AAGACAGGGTGGAGAAGATCAACAGTGACTTGCTGAAGAAACTGATGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33245
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027092 Essential Splice Site 541 751 18 23
ENSDART00000144696 Essential Splice Site 556 766 18 23

The following transcripts of ENSDARG00000007549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 36551666)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36497438
GRCz11 3 36639296
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCTGAAGAAACTGATGGAGCTGGACACAGATCTCAACTTCTCTGGTGG[T/G]AAATGACTGAATTTTTCTCATGAATCACAGCTGTGGTTTTTAATGCATAT
Associated Phenotype:
Not determined