Busch Lab

ZMP

mll5

Ensembl ID:
ENSDARG00000007523
ZFIN ID:
ZDB-GENE-030131-4120
Description:
Myeloid/lymphoid or mixed-lineage leukemia 5 (Trithorax homolog, Drosophila)Novel protein (Zgc:64223
Human Orthologue:
MLL5
Human Description:
myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila) [Source:HGNC Symbol;Acc
Mouse Orthologue:
Mll5
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia 5 Gene [Source:MGI Symbol;Acc:MGI:1924825]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20276 Nonsense Available for shipment Available now
sa13142 Nonsense Available for shipment Available now
sa45175 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20276
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066903 Nonsense 89 334 4 9
ENSDART00000123369 Nonsense 89 1265 4 21
ENSDART00000126732 Nonsense 89 1375 3 23
ENSDART00000130072 Nonsense 89 381 4 9
Genomic Location (Zv9):
Chromosome 4 (position 21381169)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22724504
GRCz11 4 22445479
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCGCCGGCGTCCCCACCTCCCTCGGTGCTGATCCGGCCGGGCGAGAGCT[T/A]GTTTGTGTCCGGAAGCCGGCCTGGTGAGAACTTGTTTGTGCCGGGCGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13142
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066903 None None 334 None 9
ENSDART00000123369 Nonsense 487 1265 11 21
ENSDART00000126732 Nonsense 487 1375 10 23
ENSDART00000130072 None None 381 None 9
Genomic Location (Zv9):
Chromosome 4 (position 21374414)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22717749
GRCz11 4 22438724
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTGCTCAAGCAYAACCTGGAGCCCACAGAGAATCTWGGCTCTAGCACA[C/T]GACGGCGAGGCCGTAAGGACAAAGAACCATCGCGGGACGAGAGCGGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45175
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066903 None None 334 9 9
ENSDART00000123369 None None 1265 None 21
ENSDART00000126732 None None 1375 None 23
ENSDART00000130072 Nonsense 364 381 9 9
Genomic Location (Zv9):
Chromosome 4 (position 21361273)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22704608
GRCz11 4 22425583
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCACACCACCGGATACTTGGGCACAGGATGGCACTGACCACACCCACC[A/T]AAACCCCGCCCTCCAGACGGACTCTCTCAGAGAGGGGGCGGAGCTACATC
Associated Phenotype:
Not determined