Busch Lab

ZMP

rpe65a

Ensembl ID:
ENSDARG00000007480
ZFIN ID:
ZDB-GENE-040426-1717
Description:
retinal pigment epithelium abundant protein RPE65 [Source:RefSeq peptide;Acc:NP_957045]
Human Orthologue:
RPE65
Human Description:
retinal pigment epithelium-specific protein 65kDa [Source:HGNC Symbol;Acc:10294]
Mouse Orthologue:
Rpe65
Mouse Description:
retinal pigment epithelium 65 Gene [Source:MGI Symbol;Acc:MGI:98001]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa16919 Nonsense Available for shipment Available now
sa44520 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30810 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25736
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004533 Essential Splice Site 118 531 4 14
Genomic Location (Zv9):
Chromosome 2 (position 2460967)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2328619
GRCz11 2 1441037
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTTGGGACCTGTGCATATCCAGATCCCTGCAAGAACATCTTCTCCAGG[T/G]TTGACTGAACACTGAAGCTGTATTAGTTAATGCATTTACTAGCATGAACA
Long Flanking Sequence:
TGATGGACAGGCGCTAATGCACAAGTTTGATTTCAGCAACGGACAAGTCACTTATTTCCGCAAGTATGTCCAGTAGTGTTCATAAGGCTGTCATGAAAACCTTTATAAACATAATTATAGATGTACAGTTGAATTATTCGTCCCCCTGTTATTTTTTCCCTAATTCCTGTTTAACGGAGAGCAGATTTCTAATCATAATAGTGTTAATAACTCATCTCTAATCACTGATTTATTTCATCTTTGCCATGATGACAGTAAATAATATGAGACTAGATATTCTTCAAGACACTCCTAAACAGCTTAAAGTCACATTTAAAGGCTTAATTAGGTAATGTGTGGAAAGGGGTGGAATAGACAGGTCTTATACAACACTTTCTATTCGTCCTCACAGGTTTGTGAAAACAGATGCGTATGTGCGCGCCATAACAGAGAAACGGGTGGTCATTACGGAGTTTGGGACCTGTGCATATCCAGATCCCTGCAAGAACATCTTCTCCAGG[T/G]TTGACTGAACACTGAAGCTGTATTAGTTAATGCATTTACTAGCATGAACAAACAATAAACAATATATTTATTACAGTATTTGTGTCATGTTAGTTAACGTTAGCTAATGAAAATACAGTCATTGGTTGTTACTGTTAACCCATGCTGCATTCATGTTTAAAAGCATGAAAATGGATTTTTGTAATAAGTTAGTAAATGTTGAACTGTCATTATTAGTAAAAAAAAAAACTATTGTTAATCAAATTAAATCAAATCAGGCCTTTATTTGTCACATACACTTTCGTATAGTGAAATTAAACCCCCCCCCAACCGTACACAAACATCACAATTTTCGGGGGAGTACAGGTCACAGGAGGTAGCATATAGAAAAGGAAGTAAGATACATCACCAGACCCGCCCACCTCCTCCTGTGGGTGAGAGCACATGAAGACGTTTGGATGAGGGGATCGGTAGTGATTGTTTATCTGTAGTTGTGTATGTGTGTGTCCAACAGGTGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16919
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004533 Nonsense 169 531 6 14
Genomic Location (Zv9):
Chromosome 2 (position 2459727)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2327379
GRCz11 2 1439797
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TWTCAATCTTTAATAACCTCCGCTTGATGACCCCTGCAGGTTGACATGTG[T/A]AATTATGTGAACATYAATGGAGTCACGGCGCATCCTCACATCGAGAGAGA
Long Flanking Sequence:
GTTTTACACACAGTTGAAGTGAGAATTATTCGCACTCCTATGAAATTTGTATTTTTTTTTTCTTCCAATATTTCCCAAATGATGTTGAACAGATTCAGGAGTTTCTCACAGTATTTCCTCTGATATCTGTTCTTCTGGAGAAAGTCTTATTTGTTTTATTTCTGCTAGAATAAAGTCATTTCTTAATTGTTTTAAACCAATATTATGGTCAATATTATTAGCCCCCTTGAGCAATATTTGTGTTGAATTGTCTCCAGAACAAACCACTGTTATACAAAGACTTTCCTAATTACCCTAACTGTACCCTGATTACCCTAGTGAAGCCTTTACATGGCACTTTAAGCTGAACACTAGTGTCTTGAAGAATATCTAGTCTAATATTATGTCATCATGACAAAGATAAAATGATTAAATGATAAAATAACAAATATTTATTTTTCCTACTATGGATATCAATCTTTAATAACCTCCGCTTGATGACCCCTGCAGGTTGACATGTG[T/A]AATTATGTGAACATCAATGGAGTCACGGCGCATCCTCACATCGAGAGAGACGGGACGGTCTACAACATTGGGAACTGCATGGGCAAAGGAGCGTCGCTGGCCTACAATATCGTCCGAATCCCACCTACACAAAAGGGTGAGCAGTCAAGCATCTTAAAGGGCACCTATTATGCAAAAAACACTTTTATAATGGGTAGTGTGTCAGCAGTGTGTGAATATAACCGCCTTCTAATGATAAACATGAATTAATTGCATTGTTTATAATTAAACAGTCTGCAGAAACACTTTGATTGACATTCTCCCTTTGTATGATGTCATCAGAGGGGGAAAGCCCCGCCCACTAGTGCCCATCTCATCAGCATAAACAGCAGCCCTGAGTGAGAAGCAGCCGTCTGTCCATTAGCCATCAGAGTGTTTGAGCTGCTGAAGATCATGTCAGCATAGACTAAGAGGATTATAGATGTGGAGTTTTAGATAAACAGCGACAGGAGCGACATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44520
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004533 Essential Splice Site 286 531 8 14
Genomic Location (Zv9):
Chromosome 2 (position 2455117)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2322769
GRCz11 2 1435187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGAGGATCCAACTATATGGACTGCTTCGAGTCGGATGAAGAGAAAGGC[G/A]TAGGTTCCTCTTTATCTCACACTCGTTTTATCCGCACTATGGTGCTGCTT
Long Flanking Sequence:
GTGTGTGTTTGAATGAGTGTGTATGGGTGTTTCCCAGTACTGGGTTGCGGCTGGAAGGGTATACGCTGTGTGAAACATCCTGGAATAGCTGGTGGTTCATTCCGCTGTGGTGACCCCTGATAAATAAGGGACTAAGGCGAAGGAAAATAAATAAATGAACAATCACAGGACTGAACATGTGTATTAAATAAGTGAATATTGCAAAAGTTTCAGATATGTAAGCATGTCTTGTGTTGTTTAGTGGCAATATTATCACAGTATATTAGTATAGGGAATATTTTCACCCTAGAATGACTTATAAACTCATTTATAGTTTCTTCAATTGTTAATTTATTAACACCAAATTCTCCCCCGTGTGTTCTTGTAGTTTTGGGATGACGGAGAACTACTTTGTCTTTGTGGAGACGCCTGTGAAAATCAACCTGCTGAAGTTTCTGAGCGCCTGGAGCATCAGAGGATCCAACTATATGGACTGCTTCGAGTCGGATGAAGAGAAAGGC[G/A]TAGGTTCCTCTTTATCTCACACTCGTTTTATCCGCACTATGGTGCTGCTTTTAAGTGAGCTTTAATCATTAGACTGAATGACTGAACTTTAGGAGGCTTTAAACGTTTATCTTCAAGTAATAATGTAGTTTATTCAAAATATTGGTAGTTCTGTAATCATTCAGTCCTTTTATTTTATTATTTATGTGTAAAGCACTTTTAAAAGCAACACAGGGTTTATAATATTTAATATTTTGAGATTTTGAAGTGTAGATCCTCATTTATGGAGGCATTATAAGGGGTTATTATTAGCATCTCTGCATTAGTACAAAGTAGTGTAATATACAACATATTAATAGAAGATTTGTGTCAGTAAACATTTTAGTTGTAAATATATATTTATGAGGGTGGCGCACTGGTTAGCCCTGTCCCCTGACAGCTTGAACGTTGCTGGTTCGAGCCCAGACTTGGCCAGTTGGTGCTTCTGTGTGGAGTTTGCATGTTCTCCCTGTGTTGGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30810
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004533 Nonsense 461 531 13 14
Genomic Location (Zv9):
Chromosome 2 (position 2450156)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2317808
GRCz11 2 1430226
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTATAGATTTGCAAGCTGAATGTGAGGACTAAGGAGACCTGGGTATGG[C/T]AGGAGCCCGACTCGTACCCTTCGGAGCCGCTGTTTGTACAGACTCCTGAC
Long Flanking Sequence:
ATTATGCATTTCTCATTGAATACAGGTCAACAAAAACAGATTTATTAAACGGATATATTCATTAATATAATATTTTAGTCACTAAACATCTTTAGAAATAGAAAGATAATACATTTAAATTCATGCAAAACTAAAAAATGTCAGCAAAATGTTATATATATTTTGCTTCTCCTGAATTTTGCCCTTTTTCAAAATTGTATTTCATATTTTTCCCTAACATATTGTTTGGGTGTACTAATTTTGGAGCGTTCTCATAAGTTATTTTGTTAGATAAGCTCCAGATTTGGCTTCAGTATTGACTAATCTAATGTACAGTATATGCTTAAATCTAATATTGTAGAGCTTCCTATAGATATGAATTTAAATGTGAGACTTTTGAGTGGTGCACTCATATATGTCGAACGCTGTATATCAAGTGTGTAAGTATGCATTTTCAGGCTGTATTTGGTGCTTTATAGATTTGCAAGCTGAATGTGAGGACTAAGGAGACCTGGGTATGG[C/T]AGGAGCCCGACTCGTACCCTTCGGAGCCGCTGTTTGTACAGACTCCTGACGGAGTGGATGAGGACGACGGTCAGTTCATTATAATATACTGTTCCCATTCTGTTTGGATCCCCAGAGCACAAATCTAGTGATTCAAATGATCTGTTCAGAGTGAATCTCCGGTAAACAACTCACTGATTCAAATGATCTGTTCAGAGTGAATCTGCGGTAAACAACTCACTGATTCAAATGATCTGTTCAGAGTGAATCTGCAGTAAACAACTCACTGATTCAAATGATCTGTTCAGAGTGAATCTGCGGTAAACAACTCACTGATTCAAATGATCTGTTCAGAGTGAATCTCCCGTAAACAACTCACTGATTCAAATGATCTGTTCAGAGTGAATCTGCGGTAAACAACTCACTGATTCAAATGATCTGTTCAGAGTGAATCTGCGGTAAACAACTCACTGATTCAAATGATCTGTTCAGAGTGAATTTCCGGTCAACAACTCACTGAT
Associated Phenotype:
Not determined