Busch Lab

ZMP

tdrd1

Ensembl ID:
ENSDARG00000007465
ZFIN ID:
ZDB-GENE-070803-1
Description:
Tudor domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q58EK5]
Human Orthologue:
TDRD1
Human Description:
tudor domain containing 1 [Source:HGNC Symbol;Acc:11712]
Mouse Orthologue:
Tdrd1
Mouse Description:
tudor domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1933218]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa16285 Essential Splice Site Available for shipment Available now
sa42057 Nonsense Mutation detected in F1 DNA Not yet available
sa7364 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16285
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066249 Essential Splice Site 128 1176 4 25
Genomic Location (Zv9):
Chromosome 12 (position 31932350)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30241693
GRCz11 12 30356595
KASP Assay ID:
2260-5532.1 (used for ordering genotyping assays)
KASP Sequence:
GGATCGCACATCGACATGTTTGCAAACCCAGCATTCCAGAAGTCACAAGG[T/A]AATATTATTTATATTCTGTTTATAACTCATTTTGAATGTTAGTTTTGATG
Long Flanking Sequence:
GTAAAGTGGACTATTTTAAAAATACAATGTTCACATCAAAGAAATAAATTTGAGTAAAACATATTTGCCATGTTTACGTTTTAGTCATGTTTATCAAGAAACATTTTCCTTAACTGATTATGTAATGGAGAATTTATCAATTATATTTATAGAGCAAAATCATTAAATATTATTGTATGTATTAAATACAATTTAGTGAAATATTTTTCTAGTGAAAGATTTGACAAAAAAATGAGGAAGACATGCTTTTTAGTCCATCTGCAAAACGGTTCTGCCCAATAATAATGGTACAAATGTTTTTTTTTAATCATCAGAATGAGTAGGTCACTTACTAGTGATGAATTATTTATTTTTATTTTTATTTTTATTTTAAATCCTGTTTAGGCAACTTAAGGTGCACTCGGTGTAAAAAAACTTGCTACTGTTCTGTAGCTTGTCAGACTCAGGATTGGATCGCACATCGACATGTTTGCAAACCCAGCATTCCAGAAGTCACAAGG[T/A]AATATTATTTATATTCTGTTTATAACTCATTTTGAATGTTAGTTTTGATGCACAATGGCAATATTATCCTTCATTTTCATTTAGTGAAAAACCTAAGGAGTCAAAAGCTGTGCCATATGCAAATGGACTTGGTGGCACTCAAGCTAAGGTATTTTATTTGTTGTTACATTAACTAATACTTTTAATTGCTCATTCCTTCTAATTGCATCTCTGCTTTTGAAGGAGATCTCTGTTGATGCACAGCCTAAGAGAATATATCGTCGCGACTTGCACAAAAAAGTGGTTTCCAAAGGTTCTGAGATAAAGGTACTTTTCTTTAGATGTTCTTCTTTGGTTTGTTATCCAAGCATAGACACTCTGCCTCATACAAAATGCTTACAGGGCACAGTAATTGACCTGAGAAACCCTGGGATGTTCTCCATCCACTGTCAGTGCGAGGAGATGATAGAATCCCTGAAGAAGATTACCCAACAGCTTCAGAAGACCTATTGCTCTTCATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4472
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066249 Nonsense 515 1176 13 25
Genomic Location (Zv9):
Chromosome 12 (position 31929200)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30238543
GRCz11 12 30353445
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTAAATCGCTTAAGGCCGATCAGCAAGGAGCTGTTGGCTTTGGCAACA[C/T]AAGCAATCCCCTGTTCTCTAGCAGGTATACTGCAACCCTAGAACATTTGA
Long Flanking Sequence:
TTTACTGTAACTGTTGGGTTTAGGGTTGGGGTAGAGGTAGACATGTAAAATAAATAATTGGAGATTTAATAAAAAATATAAATAATTCTCGTTAACTTTCAGCTACAACTGTATAATCTAGCTACAACTCTTATAAACCCCTTCAAAAGACATGGCTACATGTAGATTTATTATGAATATATGGCAATAAAGTTAAATGAATGTTTATTAGCATTATGAAGGTGCCTAGTTTTCAATTTAATAGATTTACTAAAGTGTATTTTAATAAGTGAATTTTTTGCAAGTTGGTGAAAATATAGAGGTTTTTTTTATGCATGTGAACTACTGTAGATTTAGTCTCTTTATGCATTACAGAGGACAACCAGTGGTACAGAGCTAAAGTTCTGGCATATTCCTCTGAGGATCGTGTGTGTGTTGGATACATAGACTTTGGAAACTCTGAGGAGGTTGAGCTAAATCGCTTAAGGCCGATCAGCAAGGAGCTGTTGGCTTTGGCAACA[C/T]AAGCAATCCCCTGTTCTCTAGCAGGTATACTGCAACCCTAGAACATTTGAAAATTGGTTCAGAATTGCTTGCATGAAGTCAGAATTCAGCAAGGGTTTTGATTGTGTTCTTGCTGAACATGTTAATGTTTCTCCAGGTATAAAGTCTCTAACAGACACCTGGTCTGATGAGGCAGTTCTGATGTTAAAACATCTGGTGTGCAACCGCTTCATTCGGGTTGAGATTCTGGGTAAAAAGGACGGTAGGGCTCTGGTGTCCATGATCGATGAGTCCAGTGATCCTCAGGCCAGTGTCACAGAGCTGTTGGTTAACATGGGTTTTGCTGCTATAGAAAGTGTGGAAACCAAGAAGAATGAACCAGATCCAGCTACCTCCACTGAAATTCCCCGTAAGTGAAGTATTCCTTGATTTTTAGGTGTTTTTTTTTTTTTTTGTTTTTTGAAAAGACAATATATGTAAAGATTTTTTAATTGCGTTATAGCCCTAAGTCAACCTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42057
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066249 Nonsense 668 1176 16 25
Genomic Location (Zv9):
Chromosome 12 (position 31928453)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30237796
GRCz11 12 30352698
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGACGAACACACCCTGACAGAGATGTCCTTTGAGCTTATGAAACACTGT[G/T]AATCAGAGAGAGCTCCCTTTACCCCTATTGTAGGAGAACCATGTTGTGCT
Long Flanking Sequence:
GCTCTGGTGTCCATGATCGATGAGTCCAGTGATCCTCAGGCCAGTGTCACAGAGCTGTTGGTTAACATGGGTTTTGCTGCTATAGAAAGTGTGGAAACCAAGAAGAATGAACCAGATCCAGCTACCTCCACTGAAATTCCCCGTAAGTGAAGTATTCCTTGATTTTTAGGTGTTTTTTTTTTTTTTTGTTTTTTGAAAAGACAATATATGTAAAGATTTTTTAATTGCGTTATAGCCCTAAGTCAACCTGTTGTTGAGAAATTGGAGTGGACTGGTGCTGAACTTCCCTTTGATGGCCAGAAGGTGGAGCTGGTGATTAGTACACTGAAGAGCCTTGATGAATTCTACTGTTACAACTACAGTAAAACAGGTGCCTTGATTGTCTATCAGTGTTGCCTTTCCTGCAGTGTGACGTATGTTTGTAATTAAGTGTTTTATTTTTGTGTCTGGCAGACGAACACACCCTGACAGAGATGTCCTTTGAGCTTATGAAACACTGT[G/T]AATCAGAGAGAGCTCCCTTTACCCCTATTGTAGGAGAACCATGTTGTGCTCTCTTCACAGGTAACACGGACTCCATCATTAAGAAGTAAACATATATATTTTTTTTATTTTTTCTAATTTAGTAATAAAAGATGACTTGAATTTAAGATGTTTACTGTTCAAAATTTAAGATTTATTAACTTTTTTTTAAAATGTTTTTATTTATTCATTTTTGTATGTTAAATTCTCAACAGTCATTAATGGTACATGATTGTTGATTTAATGTTTGATGCTCAATTTTTTTTTTCTTTATTGCAAGTGTTTTTTTCCCTTTTTTTGGAAATGGTTGTGCATTTTTTCCAGCTTTATTTTAATAGAAAGTTCTAAAAATATCCTTCATTTAGAAATATTAGCAATTTGTATGGGTAATTGACATGTTTTGCTGTAAAAATGTGAGCTAATGTGCAGTAGAGCATAAAGGTATAGAAATAGCTGTTCTAAACTACTCTGAGCTACTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7364
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066249 Missense 795 1176 18 25
Genomic Location (Zv9):
Chromosome 12 (position 31927361)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30236704
GRCz11 12 30351606
KASP Assay ID:
554-4074.1 (used for ordering genotyping assays)
KASP Sequence:
TRAGAAGGGTTATGGGATGGAGCTRGAAAGKGCTGGACAAACTGTTGCTT[C/T]TGTGCTCATCTCTGAGCACCTGGMTAAACCTTACGGACAGGTCAGACAGC
Long Flanking Sequence:
CAAAAAACACAACTGATTGACCATAAACTTTTAATTGGTAAGTTACAGAATATCAGTGTGACTTGTTTTCCTTTCTGCTATGCAGGAGACGCCCGCTGGTACAGAGCCATGGTGTTAGAGGTGTGTGGAGAGGGTAAAGCTAGAGTTTGTTTTGTGGATTATGGGAACTCCTGTGAGGTGGATGCAGCACACCTCAAGGCCATCACACAGAGCCTGCTAAAACTGCCCTTCCAGGCAATACGCTGCTGGCTTGCAGGTTTGTTTACTTCATTAGTGTTTGCATTGCTGTGAAATATTAGTAAAAATAGTGAATGTATTGTGTTTATGACTGTAATTGCTTTTATATGCAGGAGTGGAACCAGTGGAGGGCCAGTGGAAAAAAGAAGCTATGCTTAGGTTTCAGGCTCTTTGTGCCGGCCAGCCTTTGAGTGGCAAAGTGCTTTCCATCACTGAGAAGGGTTATGGGATGGAGCTGGAAAGTGCTGGACAAACTGTTGCTT[C/T]TGTGCTCATCTCTGAGCACCTGGCTAAACCTTACGGACAGGTCAGACAGCCTCCGCAAATACAGCCAGCTAAACCCGCCAGTCAGATTGAAGATCTGCCCTCTCTTAAACCCATTGATCAGAATCCATCTGTTGAAGAGCCTTTGAAAGTTAGCAGCAAGGGAGCTGCCACTACCCCAGAAGATTTACCAGTGTCAAGTATAAGTTTTAACTGACAGTTTTGTAATAGCCAGTATCAGCAATTTGCAAGCCATCGTTTGATTGTTGTCCTTGTGCATGATTAACTTTTTTTTTTTTCCTTTTTTTTTTTAACCTGTCATTTAGGTGGCTGTTTTCCTTTAAACTGGAAGACATTGGAGCTGTCTTGCAGTGGCACTTTCCAACCAAGAGTGGCAGCAGTAATCAGCCCTAGTCTCTTTTACATTATGAATCCTGGACAAGGTTTGCACTCATCTCATAGCATTTTAAGTGCACCATAATGCTATTTTAATGGTTCGTACA
Associated Phenotype:
Not determined