Busch Lab

ZMP

si:ch211-238a12.4

Ensembl ID:
ENSDARG00000007461
ZFIN ID:
ZDB-GENE-050420-284
Description:
Novel protein similar to H.sapiens SRGAP1, SLIT-ROBO Rho GTPase activating protein 1 (SRGAP1) [Sourc
Human Orthologue:
SRGAP1
Human Description:
SLIT-ROBO Rho GTPase activating protein 1 [Source:HGNC Symbol;Acc:17382]
Mouse Orthologue:
Srgap1
Mouse Description:
SLIT-ROBO Rho GTPase activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:2152936]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa43065 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25055 Nonsense Mutation detected in F1 DNA Not yet available
sa23247 Nonsense Available for shipment Available now
sa16150 Nonsense Available for shipment Available now
sa36592 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32190 Essential Splice Site Available for shipment Available now
sa43064 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43065
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Essential Splice Site 167 1073 4 22
ENSDART00000140403 None None 929 None 18
Genomic Location (Zv9):
Chromosome 18 (position 12411385)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12994014
GRCz11 18 12962732
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTCAGCTGCAAGAAGATTTGATGAAAGTCCTCAACGAGCTCTACACGG[T/C]AAGTACTGTAACACTTATCACATTTGTCGAATTCTAGAAAGTTCCTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25055
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Nonsense 175 1073 5 22
ENSDART00000140403 Nonsense 8 929 1 18
Genomic Location (Zv9):
Chromosome 18 (position 12405981)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12988710
GRCz11 18 12957428
KASP Assay ID:
554-7419.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTGATCTCTGATCTGTGTCCCGCAGGTGATGAAGACCTATCATATGTA[T/A]CACACAGAGAGCATCAGTGCTGAGGGTAAACTGAAGGAGGCTGAGAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23247
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Nonsense 339 1073 7 22
ENSDART00000140403 Nonsense 172 929 3 18
Genomic Location (Zv9):
Chromosome 18 (position 12398361)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12981090
GRCz11 18 12949808
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATGGAAATGTACCCGACCGCCTTCTGCCCTCCCGTCAAATTTGAGTTT[C/T]AGGCACATATGGGAGACGAGGTCAGTTTTAATTATAATTTTGGATTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16150
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Nonsense 400 1073 9 22
ENSDART00000140403 Nonsense 233 929 5 18
Genomic Location (Zv9):
Chromosome 18 (position 12379956)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12962685
GRCz11 18 12931403
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGAGGCRACACTTACTACCATCCAGGACATGGTGACGGTTGAGGATTA[T/A]GACGTATCTGAAWRTTTCCATCATAGCCGCTCAACTGAATCAGTTAAATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28995
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Essential Splice Site 696 1073 17 22
ENSDART00000140403 Essential Splice Site 552 929 13 18
Genomic Location (Zv9):
Chromosome 18 (position 12355918)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12938647
GRCz11 18 12907365
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTAGACGGCCCCCTGTATGAGAAGTGTATGGCAGGTGGAGATTATTGG[T/G]GAGTAAAAGGAGAGGGTTTTAATAATTGATTGATAACTGTCTGGACGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36592
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Essential Splice Site 723 1073 18 22
ENSDART00000140403 Essential Splice Site 579 929 14 18
Genomic Location (Zv9):
Chromosome 18 (position 12351444)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12934173
GRCz11 18 12902891
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGAGGTTGATCAGGATGGAGGAGCAGAGACCCACACCAGTGAGGATGG[T/A]AAGCTTGTTTTTGTTGTTGTTTTTGTTGTACATCCTGTAGGGATATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32190
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Essential Splice Site 783 1073 19 22
ENSDART00000140403 Essential Splice Site 639 929 15 18
Genomic Location (Zv9):
Chromosome 18 (position 12337595)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12920324
GRCz11 18 12889042
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGGCATAGATGGACTCGTGCCTCACCAGTACATTGTTGTTCAGGATAT[G/A]TGAGTATCTGAACTGTTTAGTCAGCAAAATAAAACTTCACTGTAATGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43064
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088908 Nonsense 840 1073 21 22
ENSDART00000140403 Nonsense 696 929 17 18
Genomic Location (Zv9):
Chromosome 18 (position 12320244)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 12902973
GRCz11 18 12871691
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTCTCTCCATTTACCAGGCACAGAAAGAGAAGTGACCCTCCAACCCGC[A/T]GACCTCCGGCTCGCCCAACTGACACCCACTGCCTCGTCCACCCATCTCAT
Associated Phenotype:
Not determined