Busch Lab

ZMP

fbxl18

Ensembl ID:
ENSDARG00000007443
ZFIN ID:
ZDB-GENE-050913-65
Description:
F-box/LRR-repeat protein 18 [Source:RefSeq peptide;Acc:NP_001025416]
Human Orthologue:
FBXL18
Human Description:
F-box and leucine-rich repeat protein 18 [Source:HGNC Symbol;Acc:21874]
Mouse Orthologue:
Fbxl18
Mouse Description:
F-box and leucine-rich repeat protein 18 Gene [Source:MGI Symbol;Acc:MGI:2444450]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39545 Nonsense Mutation detected in F1 DNA Not yet available
sa767 Nonsense F2 line generated Not yet available
sa9554 Nonsense Available for shipment Available now
sa19420 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39545
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103644 Nonsense 118 720 3 5
Genomic Location (Zv9):
Chromosome 1 (position 7720202)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7960007
GRCz11 1 8644118
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCCGGCTCTACAGTGGATCAGGTCACCCGCTGTAAGTCTTTGGTCAGTT[T/A]GGACCTTTCCGGCTGCAGATTGACATCAGTTCGCCTCTCGCATCTGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa767
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103644 Nonsense 307 720 3 5
Genomic Location (Zv9):
Chromosome 1 (position 7719635)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7959440
GRCz11 1 8643551
KASP Assay ID:
554-0673.1 (used for ordering genotyping assays)
KASP Sequence:
TTTGCAGCTTCCACGTACATGGTTGGACGGTGCTATACTTGGGCGGGTRT[T/A]AGCGCATGGATGTCCTGCATACCTGAATGTCTCCCGGTGTTCATCTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9554
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103644 Nonsense 598 720 3 5
Genomic Location (Zv9):
Chromosome 1 (position 7718762)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7958567
GRCz11 1 8642678
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACGCAGGCCCTGCTGGAGGCTCTTTCCTACTGCACACAASTCAGGGAST[T/A]AAGGTGAGCGTGCAYGCCAATACTCAAAAKGTAATCAATAAGGTTGTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19420
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103644 Nonsense 625 720 4 5
Genomic Location (Zv9):
Chromosome 1 (position 7716045)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7955850
GRCz11 1 8639961
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGCGTTTTTCGAAGCGCTCAGTCAGTGTGGTCAGCTGCGGCGTCTGTG[T/A]TTAGTTTCTCGACACGGCACTTTCCAACCCGCCGCTGTGACGGCCTTCAT
Associated Phenotype:
Not determined