Busch Lab

ZMP

arid2

Ensembl ID:
ENSDARG00000007413
ZFIN ID:
ZDB-GENE-030131-6311
Description:
AT-rich interactive domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001071231]
Human Orthologue:
ARID2
Human Description:
AT rich interactive domain 2 (ARID, RFX-like) [Source:HGNC Symbol;Acc:18037]
Mouse Orthologue:
Arid2
Mouse Description:
AT rich interactive domain 2 (ARID, RFX-like) Gene [Source:MGI Symbol;Acc:MGI:1924294]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa40197 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20174 Nonsense Available for shipment Available now
sa6926 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40197
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019144 Essential Splice Site 140 1565 5 21
ENSDART00000113360 Essential Splice Site 140 1573 5 21
Genomic Location (Zv9):
Chromosome 4 (position 1530165)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1821797
GRCz11 4 1671110
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCATGTACACATTGTGTGAATCTCTAAACCCCCTTTTCTTCTATTGGAC[A/G]GACTATCTCCGCCAAAGCTATGGGCTATCGACGGATTTTATCCCTCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20174
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019144 Nonsense 424 1565 10 21
ENSDART00000113360 Nonsense 424 1573 10 21
Genomic Location (Zv9):
Chromosome 4 (position 1520812)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1812444
GRCz11 4 1661757
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGACGCTGCCGGACGTCATGCTGGTCATCTCTGCGCTGGAGGTCCTGTA[T/A]CAGCTGGCTGAGCTCGGAGAGATAACCTGCTCCAAAATCTCCTCCGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6926
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019144 Nonsense 1381 1565 16 21
ENSDART00000113360 Nonsense 1382 1573 16 21
Genomic Location (Zv9):
Chromosome 4 (position 1515418)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1807050
GRCz11 4 1656363
KASP Assay ID:
554-5063.1 (used for ordering genotyping assays)
KASP Sequence:
CCCGCCCTCTCTCCAGAGCAAACRCGGAAACCTGGACAGAACTTTAAGTG[T/A]CTGTGGCAAGCATGCAAACGGTAAGAAAGCAYGCTTTACRGATGTWCTTC
Associated Phenotype:
Not determined