Busch Lab

ZMP

ppif

Ensembl ID:
ENSDARG00000007409
ZFIN ID:
ZDB-GENE-040912-52
Description:
peptidyl-prolyl cis-trans isomerase A [Source:RefSeq peptide;Acc:NP_001004626]
Human Orthologue:
PPIF
Human Description:
peptidylprolyl isomerase F [Source:HGNC Symbol;Acc:9259]
Mouse Orthologue:
Ppif
Mouse Description:
peptidylprolyl isomerase F (cyclophilin F) Gene [Source:MGI Symbol;Acc:MGI:2145814]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa45489 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45489
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010052 Essential Splice Site 145 189 5 6
ENSDART00000144417 Essential Splice Site 145 154 5 6
Genomic Location (Zv9):
Chromosome 13 (position 30798846)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30444794
GRCz11 13 30575244
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAACACAAATGGTTCTCAGTTTTTCATCTGCACTGCAAAAACAGAATG[G/A]TACGCTGCTGAGGAGATTCAATCATTACCTTGGTTTTGCTTAAGCTTTGA
Associated Phenotype:
Not determined