Busch Lab

ZMP

strap

Ensembl ID:
ENSDARG00000007405
ZFIN ID:
ZDB-GENE-040426-1110
Description:
serine-threonine kinase receptor-associated protein [Source:RefSeq peptide;Acc:NP_956598]
Human Orthologue:
STRAP
Human Description:
serine/threonine kinase receptor associated protein [Source:HGNC Symbol;Acc:30796]
Mouse Orthologue:
Strap
Mouse Description:
serine/threonine kinase receptor associated protein Gene [Source:MGI Symbol;Acc:MGI:1329037]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6937 Nonsense Mutation detected in F1 DNA Not yet available
sa20250 Essential Splice Site Available for shipment Available now
sa33438 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6937
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013224 Nonsense 28 329 2 10
ENSDART00000124627 Nonsense 28 329 2 10
Genomic Location (Zv9):
Chromosome 4 (position 15950795)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16893635
GRCz11 4 16882611
KASP Assay ID:
554-5301.1 (used for ordering genotyping assays)
KASP Sequence:
GGTCACACCAGACCTGTTGTGGATCTGGCGTTCAGTGGAATAACTCCTTA[T/A]GGATATTTCCTCATTAGTGCTTGTAAAGGTTTGTATGTACTTGGACTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20250
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013224 Essential Splice Site 83 329 3 10
ENSDART00000124627 Essential Splice Site 83 329 3 10
Genomic Location (Zv9):
Chromosome 4 (position 15950197)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16893037
GRCz11 4 16882013
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAATACAGAAGCTACAAAAGCAGCAACGGCCGCAGCAGATTTTACAGCG[T/A]AAGTGTTAAAGGAATAAAAGATGAACTGTTATTGTTGAAACATGAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33438
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013224 Nonsense 251 329 8 10
ENSDART00000124627 Nonsense 251 329 8 10
Genomic Location (Zv9):
Chromosome 4 (position 15947953)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16890793
GRCz11 4 16879769
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATAAAGACTTCTTTGTGGCTGGAGGAGATGATTTCAAGCTTTACAAATA[T/G]GACTACACCACCAAAGAGGAAATGGGTATGAATATAGTTGATAATCATGT
Associated Phenotype:
Not determined