Busch Lab

ZMP

slc26a3

Ensembl ID:
ENSDARG00000007371
ZFIN ID:
ZDB-GENE-041210-180
Description:
solute carrier family 26, member 3 [Source:RefSeq peptide;Acc:NP_001129155]
Human Orthologue:
SLC26A3
Human Description:
solute carrier family 26, member 3 [Source:HGNC Symbol;Acc:3018]
Mouse Orthologue:
Slc26a3
Mouse Description:
solute carrier family 26, member 3 Gene [Source:MGI Symbol;Acc:MGI:107181]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2157
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040424 Nonsense 314 745 7 19
ENSDART00000146141 Nonsense 302 572 7 15
Genomic Location (Zv9):
Chromosome 4 (position 17896637)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18839477
GRCz11 4 18828453
KASP Assay ID:
554-2805.1 (used for ordering genotyping assays)
KASP Sequence:
AACAGACTGTTATCGCTTGCGGAGTCTCTTATGCATTCAACTTTGAAGAA[C/T]GATTTGACGTGGTCATTGTTGGGGAGATGGTGAATGGGTAAGAATCTAAC
Associated Phenotype:
Not determined