Busch Lab

ZMP

aco2

Ensembl ID:
ENSDARG00000007294
ZFIN ID:
ZDB-GENE-030131-1390
Description:
aconitate hydratase, mitochondrial [Source:RefSeq peptide;Acc:NP_944590]
Human Orthologue:
ACO2
Human Description:
aconitase 2, mitochondrial [Source:HGNC Symbol;Acc:118]
Mouse Orthologue:
Aco2
Mouse Description:
aconitase 2, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:87880]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22076 Nonsense Available for shipment Available now
sa24909 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27939
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009321 Nonsense 180 782 5 17
Genomic Location (Zv9):
Chromosome 12 (position 20211793)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18993637
GRCz11 12 19115511
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTATGTGTTCATATACATTTTATTTCATATTCTCTTTGTTTAGATCATCT[T/A]GGAAAACTATGCATACCCAGGAGTCATGTTGATTGGTACAGACTCTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22076
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009321 Nonsense 257 782 6 17
Genomic Location (Zv9):
Chromosome 12 (position 20211473)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18993317
GRCz11 12 19115191
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGGTTGGAGCTCACCAAAGGATGTCATCCTGAAAGTTGCTGGTATTT[T/A]GACTGTGAAGGGTGGCACTGGTGCCATTGTGGAGTATCATGGCCCTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24909
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009321 Essential Splice Site 346 782 8 17
Genomic Location (Zv9):
Chromosome 12 (position 20209754)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18991598
GRCz11 12 19113472
KASP Assay ID:
554-7326.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACTCGGGTTGTCATTATGACCAGCTGATTGAGATTAATCTAGATGAGG[T/G]AAGTGTAGGTCAATTGAGGTAATCCACTTAAATGTGCGTTACAGATACAG
Associated Phenotype:
Not determined