Busch Lab

ZMP

ect2

Ensembl ID:
ENSDARG00000007278
ZFIN ID:
ZDB-GENE-040831-2
Description:
protein ECT2 [Source:RefSeq peptide;Acc:NP_001003883]
Human Orthologue:
ECT2
Human Description:
epithelial cell transforming sequence 2 oncogene [Source:HGNC Symbol;Acc:3155]
Mouse Orthologue:
Ect2
Mouse Description:
ect2 oncogene Gene [Source:MGI Symbol;Acc:MGI:95281]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa35030 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41785 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27734
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011087 Essential Splice Site 224 878 8 24
ENSDART00000081827 Essential Splice Site 256 976 9 26
Genomic Location (Zv9):
Chromosome 11 (position 10493802)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 10446116
GRCz11 11 10429808
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTAAGCTTTTTAACAAATATTTTCTTTCTCTTTTTTTTTTGGCTATA[G/T]TAATTTTCACGCAGGCAACGAGCTGTTCCGCACAGAGTTTAAAGTTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35030
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011087 Essential Splice Site 506 878 15 24
ENSDART00000081827 Essential Splice Site 538 976 16 26
Genomic Location (Zv9):
Chromosome 11 (position 10485368)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 10437682
GRCz11 11 10421374
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAATGGCAGCTTTTGTGATCTCTCTTTATTTTTTCAAATTCCCTCTCA[G/A]TCTGGAGAGCTGGTGAAGGCCTACCCACCATTTGTCAACTTCTTTGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41785
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011087 Nonsense 595 878 17 24
ENSDART00000081827 Nonsense 627 976 18 26
Genomic Location (Zv9):
Chromosome 11 (position 10482768)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 10435082
GRCz11 11 10418774
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACACACATCAGATGACAACCCAGATAAATTGACACTTGAAAAGGCCATC[G/T]AGTCTCTCAAGGAAGTGATGACGTGAGTCCTTATTGTCCTTATATAAAAA
Associated Phenotype:
Not determined