Busch Lab

ZMP

ric8a

Ensembl ID:
ENSDARG00000007247
ZFIN ID:
ZDB-GENE-040927-18
Description:
Synembryn-A [Source:UniProtKB/Swiss-Prot;Acc:Q642H7]
Human Orthologue:
RIC8A
Human Description:
resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) [Source:HGNC Symbol;Acc:29550]
Mouse Orthologue:
Ric8
Mouse Description:
resistance to inhibitors of cholinesterase 8 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:21

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15715 Nonsense Available for shipment Available now
sa24616 Nonsense Available for shipment Available now
sa32519 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15715
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044738 Nonsense 56 550 3 11
ENSDART00000125288 Nonsense 10 504 1 9
ENSDART00000130354 Nonsense 62 556 4 12
Genomic Location (Zv9):
Chromosome 25 (position 10681452)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10373503
GRCz11 25 10470309
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCNNGTTTTCTCATTTCTCAGCGTCTGGGTGAGTTAGTGKTAAGCTTTT[T/A]GRAGAGAGACCTCCAGCCRTCCTGCCAGCTGGCCTGCCTRGAGACCATCC
Long Flanking Sequence:
GTGCTTATAATAAATAGATTCAATAATGGGCTAATAATAAATAGACTCAATAATGGGCTAATAATAAATAGACTCAATAATGGGCTTATAATAAATAGATTCAATAATGGGCTAATAATAAATAGACTTAATAATGGGCTAATAATAAATAGACTCAGTAATGGGCTAATAATAAATAGACTTAATGATGGGCAAATAATAAATAGACTCAATAATGGGCTAATAATAAATAGACTCAATGATGGGCAAATAATAAATAGACTCAATGATGGGCTAAAAATCTGCGGATTTCTGTGCGCACAGATTTCATGTGGGCCTAGTCATCCTTAAGTAGTAAAAGTTTGCTGAACATATATGCCGCTAAGCAATTTTCATAAGGTGCATTGAAACAAAAGCAGTGGAGAAATGCAGGCATGTAAACCAATAGTAGATGGTTTCCACCATATTACTCTCTTGTTTTCTCATTTCTCAGCGTCTGGGTGAGTTAGTGTTAAGCTTTT[T/A]GGAGAGAGACCTCCAGCCATCCTGCCAGCTGGCCTGCCTAGAGACCATCCGCATCCTGTCCCGGGACAAGAAGAGCCTGTCTCCGTTCGCCACCCGCCATGCTATGCAGATCCTGATTCGACATGCAGGGCTTGGGCAGGGAGAGGGCGTCACCCCAGAGATCCCAGATTTAGAGGTAAGGGTATGCTATAATGTCGATATTTGATCATGAATGATTAAAATGCCGCTATGACTTTATCAGAAAATATTGTTATATTGCGCAACAGTGCATTTTCAATCAGTTGCATATGACTTTCACCATAATTAAATCATTCATTGCTTCTGATTTACTTTTATTTGTCATAAAAGATTGGTACAATTTTTTGTTAAAGTCTGTGTGAAATCAAAATGGGCATGTTTATTTTGCTAGCGCACATTGTTATTCTTTAAGTGAATAATTGATCCGTGCAGGTTAATCAACTAAAAAATGTATTGGTGATCTTCAATCAAAGTATGAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24616
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044738 Nonsense 229 550 4 11
ENSDART00000125288 Nonsense 183 504 2 9
ENSDART00000130354 Nonsense 235 556 5 12
Genomic Location (Zv9):
Chromosome 25 (position 10684436)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10376487
GRCz11 25 10473293
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCGCGGGCTGGGTTCGACGGCTGCTCAGAGCTGCCCCCGCTGGGCAGA[C/T]AAGAGACCGAGAGAGTCATGGAGATCCTCAAGATCCTCTTCAATGTTACG
Long Flanking Sequence:
ACAGAAATGTATATAGCGGTACGATAAACAACGAAGCTGAAATTCGGCTCAATTAAAAGAAGAGTCACGTGATTAAAAGCAAACCCAACACCTGCAAAAATAAATATAAAAAAATACATTTGTAATATGATATTTTTTCTTCCAAATGGCCCACTTAGGTGATCGTGGAGGCTCTGAAGTGCTTATGCAACATCGTGTTTAACAGCGAAGCAGCGCAGGAGGCCGCAGCTGACCTGCAGTTGATGGTGGGTTTAGCAGAGCGGCTGAAACAGTGCCGGGAACCACAGTGGAACCATGACGTGCGTTTCTTCGATCTGCGCCTTACGTTCCTGATCACCGCCCTGCGTGTGGACGTGCGGGCTCAGCTGGCACACGAGCTGCGCGGGGTCAGTCTGCTGTCCGAGGCTTTGGACGCCACCTTTGGACTCTGCTGGCCGGACATGTATGAGGTGGCGCGGGCTGGGTTCGACGGCTGCTCAGAGCTGCCCCCGCTGGGCAGA[C/T]AAGAGACCGAGAGAGTCATGGAGATCCTCAAGATCCTCTTCAATGTTACGTTTGATTCCAACCGACGCCATGTGGACGAGGTGAGACTTGGGTTAAATATTATTAAATATTGTTTTAAGAGTGTCAGTTATTTTTAATATCGTCATAATCTCAGAAAGGTCACTGAATAAGCGTTACACACCCGCAGCAATAAGATCTGTTCCCCCTGTGTAAATGACTGCGTTTAATTAGTGAAGCAGATCTAAAATGCTTTCATGGGACTTGTGTTGTTTTGGCGTGTGTGCTGTGCTGGTGTGTGTGTGATGCAGGAGGAAGCAGCCACATACAGACACCTGGGAGCCATACTGAGACACTGCATCATGAGCAGCGCAGAGGGAGAGGAGCGAACAGAGGAGATGCACAGGTGCCCACACACACTCATGGACGCACACACAGACATCACACATACCGTACACACATCATGAGCGGCGCAGAGGGAGAAGAGTTAACAGAGGAGATGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30210
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044738 Nonsense 332 550 6 11
ENSDART00000125288 Nonsense 286 504 4 9
ENSDART00000130354 Nonsense 338 556 7 12
Genomic Location (Zv9):
Chromosome 25 (position 10687216)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10379267
GRCz11 25 10476073
KASP Assay ID:
2261-9422.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTACATGGGAGTCAACATGGATGCTGTCAAAGTGCTGGTGGAGTTCATG[G/T]AGAAAAGACTCGACCGGGTGAGAACATTAACACCTCAAATCTACACTTTA
Long Flanking Sequence:
TTCCCCACGATGCTGTCAGGGCCGATACAGCAAAGCTGTGTGTGTGCAGCAAGCATTTTTGTCGGGAGAGCAGTACAAGAATTGGAGAATGGTGGACTTTGTCTTTTATCAGGAGTTTGTTCACATTTAGACACATCTGTCCATATTTTAATATAAAATTATAAATAAATTTCTCAACTCTTCATTAAAATATCATGTTTCATGTCAAATAGTTGGACACAGTGACACACTGGCACAGATTCTCAACCGTCTTGCTCTGATTTGTAAAGATTGGTAACTATTTAGAGCAGAACCACTGGGATCTCAGCCCCAACTAATTAGTTGATTTGTTAAAGGAAAGTAAAATAGATCTGAACATGTTTTACAGCCACACAGTGAACCTTCTGGGAAACTTGCCGCTTCCGTGTCTGGACGTCCTGCTGATGCCTAAAGTCCAGCAGGGCTCCATCGAGTACATGGGAGTCAACATGGATGCTGTCAAAGTGCTGGTGGAGTTCATG[G/T]AGAAAAGACTCGACCGGGTGAGAACATTAACACCTCAAATCTACACTTTAAACCACATTGGCTCATTCTAAAAGCGTAACCCTATATACATTTCTGGAGAGCGCGAATTATGTAGCCAGAAGTACGTATTGCTAAATTGTTTTGTTTTTAACAAGAACATTATCGGGCGCTATGACGCTGTTTCTTTTCTCGCTAATAGCTGACCACTTACCTCAATATGGTAATATCATATGGATGACTTTTAAACTGTTACTAGTTTATCCAGTGGCGAGGAGTTGAAAAAATCAAGCCCGGTTGGGTTTAGGTAAGTGGGAGGGTGGGTCATTTGGTCAGTCAGTCAGTAAGTCAGTCAGTCAGTCGACAGCAATCTCTGGTGGGTTTATGTGAGAACAGCAGGCGTAAATGGCACTCGCAAGAGAAATTTGAGATCTGAAAAAGCATACACAGCGCCCTCTGGTAGATTCATGAAAAACAAAATCTGCAAAAAAAAAACGTAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32519
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044738 Essential Splice Site 369 550 7 11
ENSDART00000125288 Essential Splice Site 323 504 5 9
ENSDART00000130354 Essential Splice Site 375 556 8 12
Genomic Location (Zv9):
Chromosome 25 (position 10689856)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10381907
GRCz11 25 10478713
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGAGAGCGCTCGCATCCACAGAGAGACCAGGAAGTTTTTACGGAATAAAG[T/A]AAGATATGATGATTTCATTAGATTGTTTTATTACCTGGGCTTCGAGCATA
Long Flanking Sequence:
TAAGAGTGGGCGCATCCTTTTTAAATTAGTACATTTCCGTACAACTTAACTAGTACAAATTGTACGAGTTTGCCACTAAACCAACAAAACGTAAAAATAATTACGTTTCCAGTAACAATGGATATTTTGAAAAGCTCTCCGCAAATAAATCATCCCTGAGCTGATGTTTTGCTGTGCTTGTACCTGGTTAGGCTGAGGTGAAGCACCTGCGATGAAGATATTTTTGTCTGCTCTTTTCTGGGAGCTTCTCCACACCTGTGTTGTGCTGGTCGGTTTGTTATTGTTTTTGCGCTGGGATGTGCGATGGGAATACTTTGAGAGATTTCTACGCCTGGACACAGCTGGAGCTCCGATGTAAAACAATTTGCCTGCTCACCTGTTGATGTAGTGTTTATTTTCCCAGGGAAACAAGCTAAAGGAGACGCTTCTGCCCTCGCTGAATCTTCTAACCGAGAGCGCTCGCATCCACAGAGAGACCAGGAAGTTTTTACGGAATAAAG[T/A]AAGATATGATGATTTCATTAGATTGTTTTATTACCTGGGCTTCGAGCATAGTTTCATATAATAAAACTCTTATAAATTCTAAAGAATATCGTAAAAAATATTAATAAATACCTCAGGCCTATATATATATATATATATATATATATATATATATATAAACATCTAAGAAGTTAGTATGATATATCTACAACCCCAAATCAGAAAAAGTTGGGACAATATAGAAATGCAGATCAAAAAGAAAAAGAGAAAGTAGTGATTTCCAAATTTACTTTGACTTGTATTTCATTGCAGACAATATGAACACAAAATATTTCATGTTTTGTCTGGTCAACTTCATTTCATTTGTAAATATTAAGCCTAATCTGAACAACCATGATCTCCGATCCCTCAGGAGCGGCAGTGTATTAAGAATTGTCATTCGTCTATAAGCCATATCACCACATGGGCTCAGGACTACTTTGCCAAACTTTTGTCAAGTATCGCAATACGTAGTTACATCC
Associated Phenotype:
Not determined