Busch Lab

ZMP

ENSDARG00000007199

Ensembl ID:
ENSDARG00000007199
Human Orthologues:
CTD-2611O12.2, CTD-2611O12.3, ERMAP, RFPL1, RFPL2, RFPL3, RFPL4A, RFPL4B
Human Descriptions:
erythroblast membrane-associated protein (Scianna blood group) [Source:HGNC Symbol;Acc:15743]
ret finger protein-like 1 [Source:HGNC Symbol;Acc:9977]
ret finger protein-like 2 [Source:HGNC Symbol;Acc:9979]
ret finger protein-like 3 [Source:HGNC Symbol;Acc:9980]
ret finger protein-like 4A [Source:HGNC Symbol;Acc:16449]
ret finger protein-like 4B [Source:HGNC Symbol;Acc:33264]
Mouse Orthologues:
Ermap, Rfpl4
Mouse Descriptions:
erythroblast membrane-associated protein Gene [Source:MGI Symbol;Acc:MGI:1349816]
ret finger protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:2149590]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40889 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20935 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40889
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073484 Essential Splice Site 300 544 4 7
Genomic Location (Zv9):
Chromosome 7 (position 26872151)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25433897
GRCz11 7 25705054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAGCTGGAGGAGCTCTCACACACTGAAGATCACCTGCACCTCCTACAG[G/A]TCAGTCTCTCTTACCTCACATAACAGGGTAGAACTTCTCATTCTAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20935
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073484 Nonsense 391 544 7 7
Genomic Location (Zv9):
Chromosome 7 (position 26876165)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25437911
GRCz11 7 25709068
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACTCGTCCTGTCTAAAAATGGGAAACAAGTGAGTCATGGAGGAACCTG[G/A]ACAGATGTTCCCAATAACCCTGAGAGATTTGACACATCTGCCTGTGTCCT
Associated Phenotype:
Not determined