Busch Lab

ZMP

acat2

Ensembl ID:
ENSDARG00000007127
ZFIN ID:
ZDB-GENE-990714-22
Description:
acetyl-CoA acetyltransferase, cytosolic [Source:RefSeq peptide;Acc:NP_571445]
Human Orthologue:
ACAT2
Human Description:
acetyl-CoA acetyltransferase 2 [Source:HGNC Symbol;Acc:94]
Mouse Orthologues:
Acat2, Acat3
Mouse Descriptions:
acetyl-Coenzyme A acetyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:87871]
acetyl-Coenzyme A acetyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:109182]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32299 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4910
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006778 Essential Splice Site 302 395 None 9
ENSDART00000062541 Essential Splice Site None 190 None 8
ENSDART00000146376 None None 190 None 5
Genomic Location (Zv9):
Chromosome 20 (position 30951819)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31023032
GRCz11 20 30925911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGACCCTTCAGTCATGGGCACAGGGCCAATACCAGCTATTAGAAAAGCTG[T/A]GAGTGTCTGTTGAGTCATCRCAAGGTTTAATTYAAGAACACRAATGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32299
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006778 Nonsense 358 395 9 9
ENSDART00000062541 None None 190 8 8
ENSDART00000146376 None None 190 None 5
Genomic Location (Zv9):
Chromosome 20 (position 30949290)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31020503
GRCz11 20 30923382
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGGCGGAGCGATCTCTCTTGGTCATCCTCTTGGCATGTCCGGCTG[T/A]CGTGTGTTGGTGACTCTTCTTCATGCTCTTCAGAGGACAGGCGGACGGAA
Associated Phenotype:
Not determined