Busch Lab

ZMP

zgc:91985

Ensembl ID:
ENSDARG00000007108
ZFIN ID:
ZDB-GENE-040801-242
Description:
Lipase member H [Source:UniProtKB/Swiss-Prot;Acc:Q6DBU8]
Human Orthologues:
LIPH, LIPI
Human Descriptions:
lipase, member H [Source:HGNC Symbol;Acc:18483]
lipase, member I [Source:HGNC Symbol;Acc:18821]
Mouse Orthologues:
AC166995.1, Liph
Mouse Description:
lipase, member H Gene [Source:MGI Symbol;Acc:MGI:2388029]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43686 Nonsense Mutation detected in F1 DNA Not yet available
sa44973 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39339 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14145 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43686
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023838 Nonsense 12 454 2 11
ENSDART00000135222 None None 190 None 4
Genomic Location (Zv9):
Chromosome 21 (position 33933807)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34933500
GRCz11 21 34967990
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTCTTGTCTTTTGCAGATCTACAGGAAAATAATTTGGGGGATCTTATA[T/A]GTCACACTGATGTTGTTTGACACACACAGAGGTAACGTTGCACCTAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44973
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023838 Essential Splice Site 22 454 2 11
ENSDART00000135222 None None 190 None 4
Genomic Location (Zv9):
Chromosome 21 (position 33933775)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34933468
GRCz11 21 34967958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTTGGGGGATCTTATATGTCACACTGATGTTGTTTGACACACACAGAG[G/A]TAACGTTGCACCTAATGCACTCAAATTCACATTTACTCCATTGTTTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39339
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023838 Essential Splice Site 183 454 5 11
ENSDART00000135222 None None 190 None 4
Genomic Location (Zv9):
Chromosome 21 (position 33920418)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34920111
GRCz11 21 34954601
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTGTTTATGGAATTATCTTCAATGGAAATGTGTCTTCTGTTTTAATTA[G/T]CACTGGATCCAGCAGGGCCAGAGTTCAACGGTCGGCCCCCTGAGGACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14145
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023838 Nonsense 230 454 6 11
ENSDART00000135222 None None 190 None 4
Genomic Location (Zv9):
Chromosome 21 (position 33919879)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34919572
GRCz11 21 34954062
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTSTGTAGCATTAGGCTATCGAAATCTTCTGGGYCACATCGACTACTA[C/A]GCYAATGGAGGGGCAGATCAGCCAGGATGTCCTAAAACCATCCTATCAGG
Associated Phenotype:
Not determined