Busch Lab

ZMP

ccdc113

Ensembl ID:
ENSDARG00000006981
ZFIN ID:
ZDB-GENE-041010-163
Description:
Coiled-coil domain-containing protein 113 [Source:UniProtKB/Swiss-Prot;Acc:Q5XJN6]
Human Orthologue:
CCDC113
Human Description:
coiled-coil domain containing 113 [Source:HGNC Symbol;Acc:25002]
Mouse Orthologue:
Ccdc113
Mouse Description:
coiled-coil domain containing 113 Gene [Source:MGI Symbol;Acc:MGI:3606076]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa44254 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38025 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44254
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008989 Essential Splice Site 63 358 2 8
Genomic Location (Zv9):
Chromosome 25 (position 14095042)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13566617
GRCz11 25 13663017
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGGACGTTTGAAACAGTGTGGAAATGGCAGAATTTGTCAACGGAAAAGG[T/G]ACGTATTTGTGTTTAACGTTAATAAGATAAACAAGTGTGTACAGTTCTAA
Long Flanking Sequence:
GTCGTTATCATTTTGCTTTGTCAAATATGAAACGTTCCTAATGTATGTCAAGGATGCGTTTTACTTTTGTTTACGTGCTCAAAACTGTTGCCCATAGCAACCATGGCTGAAATGACAGAGGACAGCAAAAGCGGCACAGACCGAAAACAACTTGTTGAACTTGTGGGCTTAAAGTAAGTGACATAAACTAAAGCACAAAAGCTTACTTACATACAGTTCTAACGTATTCTTGCTGTCATATTTACTAAAACAGTGAAAATAGATTAGGTTTATCTTGGTGAACGAGCCGCCGCATTTTAGCTTAGCTTATCCTTTCAGCAAACAGTTATGTCGTATAGCATTTTGTGTCATATTTTCATAACGTGTTCGTGTTTTCCGCAGTTTAACTTCCAATGCAGCGCTTAATGCAGAGATTGATTTGTTTGATCGATATATTAGTCGACTGGACCTACGGACGTTTGAAACAGTGTGGAAATGGCAGAATTTGTCAACGGAAAAGG[T/G]ACGTATTTGTGTTTAACGTTAATAAGATAAACAAGTGTGTACAGTTCTAACGTAATGTTCAGTGCTTGGTGAGGTCTTTCATTAATCTGAGGTGAAATATTGTGTTTGTGTAACTGTGTAATATGCTTTAAAGCAGGGGTGTCCAAAACTTTTCTTATAAAGGGCCAAAAAACTTCATTGAGAGCTCTGGGCTGAATATATACCAAACTGCATTAACTTACATTTAATTTGCCAGGGGAAGTTTCTCATTTTTTTCAGTAATATTACAAAAAAGAAAAAAAGAAAATGTTCCACTAAATCATACTTATTATCTAATGCAGTATCGTTTTTACCATTTTTTAAAATGAAAATAGTATAGATTAACAAGAACTTAAGAACTTAACAATTCCATTTATAACACAAATAGTTCAATGCTGAATACACTAGTCGAGCTGCACCTGCCTTTACCTATATGCTTGAAGATGTACATCAAGTGACAGCATTTACATTTTAAAAGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38025
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008989 Nonsense 172 358 5 8
Genomic Location (Zv9):
Chromosome 25 (position 14097417)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13568992
GRCz11 25 13665392
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTTAAAAATCACAACGTAGTATCCAAATCTTTCCAGGACATTTTGATT[G/T]AGAAGTTGCACCGAAAAAATTCAGCACTCCTCACACACAAGAAAAAACAG
Long Flanking Sequence:
TTTGTTCGGTGAAAGTGTTTCCATTGTAGTTTATGCTCATATGTTCTTAGCGAATAAAAAGTTTACCCTACTCAGTTATGTACATTTTTTTTGCGCATTTTCAATATTTATGCACATCTTGGCATTTCCATCAACTGTTTTCTTTATGCGCACATCTAAAATCTGCGCAAAAATAGGCAGATGGAAATGTAGCTACTGTAAATTAAACTGGATTGTTATAAACACTTTCCTGATTAATGCATAAACATGTTGGTCTCAGTTCAGATGGATTTTTTTTTTTTTTTTTGATTTTTTATTCATTAACATAGAATTTTAATGGAAGGACAGAAATCTCTCAGATTTAATAAAAAAAAAGCAATTTGTGTATTAATGACAAAACAATCTTTGGAAGGTAATCAGATTGAGTAAACAATGGCAGAAATTACTTTTTTTTAATGATTTATATTACCAAATTTAAAAATCACAACGTAGTATCCAAATCTTTCCAGGACATTTTGATT[G/T]AGAAGTTGCACCGAAAAAATTCAGCACTCCTCACACACAAGAAAAAACAGCAAGCCCAGCTCAGACAACAGGAGGAGATGGCTGAGGGTGTGACAGTGTTGGACTTTGAGCTGCTCAAGTTTGAGAACATCAGATTTCGGAAGCAGCTGGATGAGCAAAACCTCAAACAAGTGAATCTCAAACTGCTTGCCGTGAAGACACTGCAGACATTAAATTCTAATAAGGTGAGATTCTCAGTCAGACGTAGATTATGTCTGATGATATTTGCTGATCTAGTATTATGACAGGAATGCATGGATAATTATTGGCATTGAGCTGCTGATCTTAAACTATAAGCGAAGTACTGTCTTGAATTTCCTCAATGTCCCCATTTTGTAGGAGAAGCTTCATATCTTGACCAATGAGTCAGAAATGCTGAGCAGTGACACGGCTTTGCGGATGAAGTTGCTGGTTAAGATTGAGGAGGAGACGGAGCAAGCGGAGGAGGTCAGGATAATTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30220
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008989 Nonsense 176 358 5 8
Genomic Location (Zv9):
Chromosome 25 (position 14097429)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13569004
GRCz11 25 13665404
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAACGTAGTATCCAAATCTTTCCAGGACATTTTGATTGAGAAGTTGCAC[C/T]GAAAAAATTCAGCACTCCTCACACACAAGAAAAAACAGCAAGCCCAGCTC
Long Flanking Sequence:
AAGTGTTTCCATTGTAGTTTATGCTCATATGTTCTTAGCGAATAAAAAGTTTACCCTACTCAGTTATGTACATTTTTTTTGCGCATTTTCAATATTTATGCACATCTTGGCATTTCCATCAACTGTTTTCTTTATGCGCACATCTAAAATCTGCGCAAAAATAGGCAGATGGAAATGTAGCTACTGTAAATTAAACTGGATTGTTATAAACACTTTCCTGATTAATGCATAAACATGTTGGTCTCAGTTCAGATGGATTTTTTTTTTTTTTTTTGATTTTTTATTCATTAACATAGAATTTTAATGGAAGGACAGAAATCTCTCAGATTTAATAAAAAAAAAGCAATTTGTGTATTAATGACAAAACAATCTTTGGAAGGTAATCAGATTGAGTAAACAATGGCAGAAATTACTTTTTTTTAATGATTTATATTACCAAATTTAAAAATCACAACGTAGTATCCAAATCTTTCCAGGACATTTTGATTGAGAAGTTGCAC[C/T]GAAAAAATTCAGCACTCCTCACACACAAGAAAAAACAGCAAGCCCAGCTCAGACAACAGGAGGAGATGGCTGAGGGTGTGACAGTGTTGGACTTTGAGCTGCTCAAGTTTGAGAACATCAGATTTCGGAAGCAGCTGGATGAGCAAAACCTCAAACAAGTGAATCTCAAACTGCTTGCCGTGAAGACACTGCAGACATTAAATTCTAATAAGGTGAGATTCTCAGTCAGACGTAGATTATGTCTGATGATATTTGCTGATCTAGTATTATGACAGGAATGCATGGATAATTATTGGCATTGAGCTGCTGATCTTAAACTATAAGCGAAGTACTGTCTTGAATTTCCTCAATGTCCCCATTTTGTAGGAGAAGCTTCATATCTTGACCAATGAGTCAGAAATGCTGAGCAGTGACACGGCTTTGCGGATGAAGTTGCTGGTTAAGATTGAGGAGGAGACGGAGCAAGCGGAGGAGGTCAGGATAATTCAATTCTTTAACGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3322
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008989 Essential Splice Site 335 358 8 8
Genomic Location (Zv9):
Chromosome 25 (position 14100124)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 13571699
GRCz11 25 13668099
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATACATGTTTGTTTGTTTNTTTTTAATGTTCAAATTCTTGCATTATTTCC[A/T]GATGGCATTAAAAACCTACACAAAATCCTGGGAAAAGCTTCGATTTGCTG
Long Flanking Sequence:
TTAGCTAACAATTCGTTTTGCTAACATGTTTTAACATTTATTATCAAGCTGCTTATGTGTTTAACAATAAATAACATGTCATTTACATGAAATGCCAATCCACTTGCTATGCATAATACATTATTTTAATAGAAACACTTTTCATACAGTTTATGTACATCATTGTCCTGTAAACATGCCCTAAAAGGCAATTAGATTGGCACTCCACTGACCAAAACCCATAGTATGGATTTTTTTCTTCTTCCCCTGACAGGAGCGACACAAAGCAGAGGCTCTAAACAGGAAGCTGAGGGACCAGTTGGCTGACTTTCACGTACCACATGTCCTCCAATATATCAAACTTAAAGAGTCCCATGGCCAGCTGCAGAAGAGTGTTAGAGAATGGGAACGAAAGGTAGAAATTGCAGAGGTGAGGATTTTGAAGTTTTTATATACATTTTTATTATTTAAATACATGTTTGTTTGTTTGTTTTTAATGTTCAAATTCTTGCATTATTTCC[A/T]GATGGCATTAAAAACCTACACAAAATCCTGGGAAAAGCTTCGATTTGCTGCTGGAGCTGGACTAGTTCCTATATAACGTGCAGTAGTAGATGCTAAATGACTATATCTGAATCAATTACAGCAAAAAAAACTCACAACAGTGTATTATTAATGAAAAGGTTTATTAGTTAGTGCTGTGTATATTAAATGCTACATACAGATATTTCAGCATTAATGTCACATCAACCGCCACATGAAGTTTTCTTACTAGCTCATTCACAATCTACAATTTGAAAAAAAGCTAAGGTGAAGTACGTGCGCTCGGAAGCGCAAAAACTTGGAACAGATAACGGGAACTAACACAGCAGGCATGCACGGGTGAAGAGGTCTCAAAACCAGAGAAAAGCCATTAAATGTAACATTTCTCTGTGGTCTTGACACTTCTGCCAAGAATATAGATATTTATATAGACATTTTAAACAATATTAATAAAAAACTTAATATATAAATGTGAAAGCATA
Associated Phenotype:
Not determined