Busch Lab

ZMP

cse1l

Ensembl ID:
ENSDARG00000006963
ZFIN ID:
ZDB-GENE-990603-1
Description:
Exportin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q7SZC2]
Human Orthologue:
CSE1L
Human Description:
CSE1 chromosome segregation 1-like (yeast) [Source:HGNC Symbol;Acc:2431]
Mouse Orthologue:
Cse1l
Mouse Description:
chromosome segregation 1-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1339951]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35010 Splice Site, Nonsense Available for shipment Available now
sa7357 Missense Mutation detected in F1 DNA Not yet available
sa35011 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35010
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013203 Splice Site, Nonsense 30 971 3 25

The following transcripts of ENSDARG00000006963 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 5556748)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5526204
GRCz11 11 5472510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCATACCTGGTATTAAATGATAAAATGTTCTTATTGTCTTCATCAGCC[G/T]AGAAGTTTCTGGAGTCGGTGGAGGGAAACCAGAACTATCCCATTTTACTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4400
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013203 Essential Splice Site 607 971 17 25

The following transcripts of ENSDARG00000006963 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 5565962)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5535418
GRCz11 11 5481724
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCACTCTCATTGGCCAACTCACACACAAGCTCCTCCTCGTCAGCAAGG[T/G]CAGCTAATCAATAAAGACAGTTCAAGAGTTGTCCAGTCATGTGRTCCTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7357
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013203 Missense 656 971 18 25

The following transcripts of ENSDARG00000006963 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 5566438)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5535894
GRCz11 11 5482200
KASP Assay ID:
554-4313.1 (used for ordering genotyping assays)
KASP Sequence:
CTTTGAAGAAGCCCTGTTTCCTGTGTTTACAGAGATCCTCCAGAATGACG[T/A]GCAGGGTATGGTGCTGGTATAAAGTTCTTACACTCCTTCTTTCCTCTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35011
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013203 Essential Splice Site 865 971 24 25

The following transcripts of ENSDARG00000006963 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 5573428)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5542884
GRCz11 11 5489190
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGACCAAGAAAGAATAATAATATTATTTAATACTCTTTTATTTTTTAA[G/A]GGCTCCTTTGCTGCAGGCTCTGATTGGTTTATTTGAGTTGCCAGAAGATG
Associated Phenotype:
Not determined