Busch Lab

ZMP

lrp5

Ensembl ID:
ENSDARG00000006921
ZFIN ID:
ZDB-GENE-050518-2
Description:
low-density lipoprotein receptor-related protein 5 [Source:RefSeq peptide;Acc:NP_001170929]
Human Orthologues:
LRP5, LRP5L
Human Descriptions:
low density lipoprotein receptor-related protein 5 [Source:HGNC Symbol;Acc:6697]
low density lipoprotein receptor-related protein 5-like [Source:HGNC Symbol;Acc:25323]
Mouse Orthologue:
Lrp5
Mouse Description:
low density lipoprotein receptor-related protein 5 Gene [Source:MGI Symbol;Acc:MGI:1278315]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa11097 Nonsense Available for shipment Available now
sa13599 Nonsense Available for shipment Available now
sa14611 Nonsense Available for shipment Available now
sa32520 Nonsense Available for shipment Available now
sa45019 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24618 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11097
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Nonsense 284 1615 5 24
Genomic Location (Zv9):
Chromosome 25 (position 10931525)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10622150
GRCz11 25 10718946
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAACAAACACAGCGGAGAGAAGCACAGGGAAATTCTCAACGGCATTTA[C/A]TCGCCGATGGACATCCAGGTGCTTGGCCAAGAGCGCCAGCCCAACAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13599
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Nonsense 347 1615 7 24
Genomic Location (Zv9):
Chromosome 25 (position 10922018)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10612643
GRCz11 25 10709439
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCACTATTGTTCTCTGAGCAAATCTCTATTTTTTTCCTAGGAGCAGAA[C/T]AGGTGCTTTTACTTGCTCGTCGCAYYGATCTTCGGCGGATATCCTTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14611
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Nonsense 406 1615 7 24
Genomic Location (Zv9):
Chromosome 25 (position 10921841)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10612466
GRCz11 25 10709262
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGGATATGTCTACTGGACGGACGATGAGTTGAGGGCTATACGGCGTGCT[C/T]GAATTGATGGAAGCGATGCCCAGACTTTAATCACCAATGAGATCAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32520
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Nonsense 932 1615 13 24
Genomic Location (Zv9):
Chromosome 25 (position 10881300)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10573260
GRCz11 25 10670056
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGGCCAGTGTGCCCACCTGTGTCTGGCATCCCCCTCTGGAGCCCAGTGT[C/T]GATGCGCGTCTCACTACACCCTGGAGGCCAACGGACGCAACTGCAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45019
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Essential Splice Site 1335 1615 19 24
Genomic Location (Zv9):
Chromosome 25 (position 10861219)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10553170
GRCz11 25 10649976
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATGGAGAGCCTGACTGCGCAGACGGCTCCGATGAACAGGACTGTGAAA[G/A]TAGGTCTCGTTTCGCAGAAGCTAGTTGCACTAATGGAAGCCATCTAAACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30211
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Essential Splice Site 1496 1615 22 24
Genomic Location (Zv9):
Chromosome 25 (position 10860445)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10552396
GRCz11 25 10649202
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCTTCATCCAGCAGCTCTTCCAGCACCAAAGGAGCATTTTACCCACAG[G/T]TACAGTGCAGTTCCTCAGTTTGTGGTCTTCTTTATTGTGTAGGCCAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24618
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121724 Essential Splice Site 1529 1615 24 24
Genomic Location (Zv9):
Chromosome 25 (position 10858417)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10550368
GRCz11 25 10647174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACAGCTAAGTATTTTTTCAGCTTTTACTGACCCAATATTCCCCTCTTT[A/C]GACCATATCTGATGCGAGGGGTCGCGCCCCCCACCACCCCCTGCAGCACA
Associated Phenotype:
Not determined