Busch Lab

ZMP

wnt8b

Ensembl ID:
ENSDARG00000006911
ZFIN ID:
ZDB-GENE-990415-279
Description:
Protein Wnt-8b [Source:UniProtKB/Swiss-Prot;Acc:P51029]
Human Orthologue:
WNT8B
Human Description:
wingless-type MMTV integration site family, member 8B [Source:HGNC Symbol;Acc:12789]
Mouse Orthologue:
Wnt8b
Mouse Description:
wingless related MMTV integration site 8b Gene [Source:MGI Symbol;Acc:MGI:109485]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17566 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2721
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049624 Nonsense 190 358 6 6
Genomic Location (Zv9):
Chromosome 13 (position 30217762)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29863710
GRCz11 13 29994160
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAGGAACCATGCAGAGGACATGCAAGTGCCATGGAGTGTCTGGCAGCTG[C/A]ACCACTCAGACCTGCTGGCTACAGTTGCCCGAGTTTCGAGAAGTGGGAAA
Long Flanking Sequence:
TATCAATTGTGTAGGACTCAACATTTTTTAGTGTATCAAGTTTTATCTTTACAGACAGACTAAACCATATCATGTTGATATTTCCTTTATAAATCCATAACTCCAATCATCCGTGTCACACAAATCGTTCTGATATGCTAAATTGGTGCTTGACCAACATTTCTTGTGAACATCAATTTTGAAAAACAATCTTACACAGAGTGAATAAGAGGACAGCTGTTTATTTCATCATTCATTTCATTATTTCATCAGTCAGGAATTATTTCACCCCCAGACTTGAACCTTGAACGGCACCCTCATCACTCACCAAATGGATGCATACGGTGCCTGCTATTGTGCACATTGTATATTCCAAGTTTGAATTAGAAAGTTTTGAAATGAGAATGTCTGCCTCCAGAACTGAGCATGAAGAGTTCTTTAACATGAGATCCTCTCTTCAACTAGGCAGTGAAAGGAACCATGCAGAGGACATGCAAGTGCCATGGAGTGTCTGGCAGCTG[C/A]ACCACTCAGACCTGCTGGCTACAGTTGCCCGAGTTTCGAGAAGTGGGAAACTACCTAAAAGAGAAGTACCACCGGGCGGTGAAGGTGGATCTGCTGCGCGGTGCAGGGAACAGCGCTGCCAGCCGTGGAGCCATTGCTGAAACCTTCAACTCCATTTCACGGAAAGAGCTGGTGCATTTGGAGGATTCTCCAGACTACTGCTTGGAGAACCGCACTCTAGGCTTGCCAGGTACTGAAGGGCGCGAGTGTTTGAGGAAGGGCAAGAATCTGAGTAAATGGGAGAAGCGCAGCTGTAAGCGGCTGTGTGGAGACTGCGGTTTGGCTGTGGAGGAGCGCAGGGCCGAAACCGTGTCTAGCTGTAACTGCAAGTTCCACTGGTGTTGTGCTGTGAAGTGCGAGCAGTGCCGCAAAACTGTCACAAAGTACTACTGTGTGAAGAGAAGCAAACGGGTCAAGAATGACAATGCCAGCCGGAGGAAAAGCTATCGGTTAAAGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17566
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049624 Nonsense 250 358 6 6
Genomic Location (Zv9):
Chromosome 13 (position 30217583)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29863531
GRCz11 13 29993981
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCCATTGCTGAAACCTTCAACTCCATTTCACGGAAAGAGCTGGTGCATT[T/A]GGAGGATTCTCCAGACTACTGCTTGGAGAACCGCACTCTAGGCTTGCCAG
Long Flanking Sequence:
TGAAAAACAATCTTACACAGAGTGAATAAGAGGACAGCTGTTTATTTCATCATTCATTTCATTATTTCATCAGTCAGGAATTATTTCACCCCCAGACTTGAACCTTGAACGGCACCCTCATCACTCACCAAATGGATGCATACGGTGCCTGCTATTGTGCACATTGTATATTCCAAGTTTGAATTAGAAAGTTTTGAAATGAGAATGTCTGCCTCCAGAACTGAGCATGAAGAGTTCTTTAACATGAGATCCTCTCTTCAACTAGGCAGTGAAAGGAACCATGCAGAGGACATGCAAGTGCCATGGAGTGTCTGGCAGCTGCACCACTCAGACCTGCTGGCTACAGTTGCCCGAGTTTCGAGAAGTGGGAAACTACCTAAAAGAGAAGTACCACCGGGCGGTGAAGGTGGATCTGCTGCGCGGTGCAGGGAACAGCGCTGCCAGCCGTGGAGCCATTGCTGAAACCTTCAACTCCATTTCACGGAAAGAGCTGGTGCATT[T/A]GGAGGATTCTCCAGACTACTGCTTGGAGAACCGCACTCTAGGCTTGCCAGGTACTGAAGGGCGCGAGTGTTTGAGGAAGGGCAAGAATCTGAGTAAATGGGAGAAGCGCAGCTGTAAGCGGCTGTGTGGAGACTGCGGTTTGGCTGTGGAGGAGCGCAGGGCCGAAACCGTGTCTAGCTGTAACTGCAAGTTCCACTGGTGTTGTGCTGTGAAGTGCGAGCAGTGCCGCAAAACTGTCACAAAGTACTACTGTGTGAAGAGAAGCAAACGGGTCAAGAATGACAATGCCAGCCGGAGGAAAAGCTATCGGTTAAAGAAGAAGCACTAGGAGATATTCTAAACTGTTCGCTATGGTGGTTTAGTTCAGCTTGTTTGGTCTAAAGAATTCTGGGTTGCTGTAACACAATATTTGGGTCAAATATGGACAAAACCAACAGTTGGGTTAAAATATTGTCATTTAAATTTAATTGATCTATTTAATTCAATGTTGATTTTGTTTT
Associated Phenotype:
Not determined