Busch Lab

ZMP

si:ch1073-459j12.1

Ensembl ID:
ENSDARG00000006901
ZFIN ID:
ZDB-GENE-030131-8546
Description:
Novel protein similat to H.sapiens AEBP1, AE binding protein 1 (AEBP1) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
AEBP1
Human Description:
AE binding protein 1 [Source:HGNC Symbol;Acc:303]
Mouse Orthologue:
Aebp1
Mouse Description:
AE binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1197012]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa45334 Nonsense Mutation detected in F1 DNA Not yet available
sa21368 Nonsense Available for shipment Available now
sa34478 Nonsense Mutation detected in F1 DNA Not yet available
sa10660 Essential Splice Site Available for shipment Available now
sa18929 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31673 Nonsense Available for shipment Available now
sa34477 Nonsense Available for shipment Available now
sa34476 Nonsense Available for shipment Available now
sa31672 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45334
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 None None 842 None 12
ENSDART00000114912 Nonsense 64 351 2 8
ENSDART00000132115 Nonsense 64 1247 2 22
Genomic Location (Zv9):
Chromosome 8 (position 46771674)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44775408
GRCz11 8 44769314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTGTTTGTTTCTTTTAGATCTTCTGCAAGTGAAAATAATTCCACCCTA[T/A]GCAACGATCGAAGTTGGACAACACAAACAATTGCTCTGCAAAGGTGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21368
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 None None 842 None 12
ENSDART00000114912 Nonsense 68 351 2 8
ENSDART00000132115 Nonsense 68 1247 2 22
Genomic Location (Zv9):
Chromosome 8 (position 46771664)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44775418
GRCz11 8 44769324
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTTTAGATCTTCTGCAAGTGAAAATAATTCCACCCTATGCAACGATC[G/T]AAGTTGGACAACACAAACAATTGCTCTGCAAAGGTGAGATGCCAGTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34478
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 None None 842 None 12
ENSDART00000114912 Nonsense 74 351 2 8
ENSDART00000132115 Nonsense 74 1247 2 22
Genomic Location (Zv9):
Chromosome 8 (position 46771646)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44775436
GRCz11 8 44769342
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTGAAAATAATTCCACCCTATGCAACGATCGAAGTTGGACAACACAAA[C/T]AATTGCTCTGCAAAGGTGAGATGCCAGTTAAAATATTAAAGAATTTAATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5506
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 None None 842 None 12
ENSDART00000114912 None None 351 None 8
ENSDART00000132115 Essential Splice Site 400 1247 11 22
Genomic Location (Zv9):
Chromosome 8 (position 46751501)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44795581
GRCz11 8 44789487
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCRCTTTCATCCATCCAAGTCACCACCACCTGTTTTTCTTTTTTATTCA[G/A]TATGTCCTCCCTTGGGTATGGAGTCTCATCGCATTGACAATGACCAGTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8324
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 Essential Splice Site 78 842 2 12
ENSDART00000114912 None None 351 None 8
ENSDART00000132115 Essential Splice Site 483 1247 12 22
Genomic Location (Zv9):
Chromosome 8 (position 46751154)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44795928
GRCz11 8 44789834
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAACAGAGTTCACAGGGGTGATCACYCAAGGACGAGATGACCCCTTAGAG[T/C]AAGGCAGATCCTAAAAACCTAGAAGCCATGTGGTTAAGTGAACTRTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10660
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 Essential Splice Site 106 842 3 12
ENSDART00000114912 None None 351 None 8
ENSDART00000132115 Essential Splice Site 511 1247 13 22
Genomic Location (Zv9):
Chromosome 8 (position 46750959)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44796123
GRCz11 8 44790029
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTAATGATAGCAGAGAGTGGACTTTYCTTCATGATGGRTATGCTGAATGG[G/A]TAGGTTGCCAGATTAGAGACCACAATCATTTTTNCTCCATATCTATTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18929
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 Essential Splice Site 184 842 5 12
ENSDART00000114912 None None 351 None 8
ENSDART00000132115 Essential Splice Site 589 1247 15 22
Genomic Location (Zv9):
Chromosome 8 (position 46746194)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44800888
GRCz11 8 44794794
KASP Assay ID:
2260-1041.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCGAGATAACCTGGACTACACCCATCACAACTACCTAGACATGGAGAAG[G/T]TGATGGAAAGCAGCATGAAGTCTCAAGAGTTCATAAGTGGCCAAAAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31673
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 Nonsense 236 842 7 12
ENSDART00000114912 None None 351 None 8
ENSDART00000132115 Nonsense 641 1247 17 22
Genomic Location (Zv9):
Chromosome 8 (position 46745710)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44801372
GRCz11 8 44795278
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTAATATGTTTCCTCAGGAGAGCCAGAATTCAGGTACACAGCTGGCTA[T/G]CATGGTAATGAGGCTTTGGGACGAGAGCTGCTTCTAATGTTCATGCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34477
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 Nonsense 254 842 7 12
ENSDART00000114912 None None 351 None 8
ENSDART00000132115 Nonsense 659 1247 17 22
Genomic Location (Zv9):
Chromosome 8 (position 46745657)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44801425
GRCz11 8 44795331
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTAATGAGGCTTTGGGACGAGAGCTGCTTCTAATGTTCATGCAGTATT[T/A]GTGTAAAGAATATAAAGATGGCAACCCTCGAGTTCGCCACCTAGTGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34476
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 Nonsense 333 842 8 12
ENSDART00000114912 None None 351 None 8
ENSDART00000132115 Nonsense 738 1247 18 22
Genomic Location (Zv9):
Chromosome 8 (position 46743771)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44803311
GRCz11 8 44797217
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTAAATAACATTTATTGGGATTCAGAGGATAAAGGCATGGTGCCCAAAT[T/A]GACACCAAATCACCATATTCCCATTCCTGAGGGTATTCTCTCAAGCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31672
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025875 Nonsense 398 842 9 12
ENSDART00000114912 None None 351 None 8
ENSDART00000132115 Nonsense 803 1247 19 22
Genomic Location (Zv9):
Chromosome 8 (position 46743460)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44803622
GRCz11 8 44797528
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACATACCCGTTTGACATGCGCCGTCTAACCAAAGAGTCTGAGGCTATG[G/T]AGAAAAAACTTGGCTCCAGAGCAAACCGACGTAAGCGACAGTATGAGGAA
Associated Phenotype:
Not determined