Busch Lab

ZMP

impdh2

Ensembl ID:
ENSDARG00000006900
ZFIN ID:
ZDB-GENE-030114-5
Description:
inosine-5'-monophosphate dehydrogenase 2 [Source:RefSeq peptide;Acc:NP_958872]
Human Orthologue:
IMPDH2
Human Description:
IMP (inosine 5'-monophosphate) dehydrogenase 2 [Source:HGNC Symbol;Acc:6053]
Mouse Orthologue:
Impdh2
Mouse Description:
inosine 5'-phosphate dehydrogenase 2 Gene [Source:MGI Symbol;Acc:MGI:109367]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41221 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41221
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009178 Nonsense 58 514 3 14
Genomic Location (Zv9):
Chromosome 8 (position 26914522)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26042440
GRCz11 8 26061579
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTTGTTAATGCTTTCATTCGTAGGACCTGACATCAGCCCTGACCAAA[C/T]AAATCACAATGAAAACCCCACTGATCTCGTCGCCTATGGATACAGTCACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5482
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009178 Nonsense 294 514 8 14
Genomic Location (Zv9):
Chromosome 8 (position 26919219)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26047137
GRCz11 8 26066276
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCAATTCCATCTTTCAGATTAATATGATCAAGTACATAAAAGAGAAATA[T/G]CCCAATGTACAGGTCATCGGAGGCAATGGTTAGTATTTAACACGCTTTAT
Associated Phenotype:
Not determined