Busch Lab

ZMP

far1

Ensembl ID:
ENSDARG00000006899
ZFIN ID:
ZDB-GENE-040426-2908
Description:
fatty acyl CoA reductase 1 [Source:RefSeq peptide;Acc:NP_998673]
Human Orthologue:
FAR1
Human Description:
fatty acyl CoA reductase 1 [Source:HGNC Symbol;Acc:26222]
Mouse Orthologue:
Far1
Mouse Description:
fatty acyl CoA reductase 1 Gene [Source:MGI Symbol;Acc:MGI:1914670]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13327 Essential Splice Site Available for shipment Available now
sa39476 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13327
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061753 Essential Splice Site None 432 1 11
ENSDART00000139778 None None 197 None 4
ENSDART00000142564 None None 181 None 3
ENSDART00000146350 Essential Splice Site None 464 1 11
ENSDART00000146604 None None 197 None 4
Genomic Location (Zv9):
Chromosome 25 (position 16437367)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15983911
GRCz11 25 16080311
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGACCGACACGCAAAAAATAGTGCGGGGAAAATATATTCAACATCCAAG[G/A]TAAGCGTACGTGTGCTTCGCGATTGTATCTGAGGTTACCTCCNTTTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39476
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061753 Essential Splice Site 256 432 6 11
ENSDART00000139778 None None 197 None 4
ENSDART00000142564 None None 181 None 3
ENSDART00000146350 Essential Splice Site 256 464 6 11
ENSDART00000146604 None None 197 None 4
Genomic Location (Zv9):
Chromosome 25 (position 16467013)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16013557
GRCz11 25 16109957
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGGGCTGGATTGACAATTTCAACGGGCCTAGCGGGATATTCATCGCTG[T/C]GAGTATCAGTGTGCTGCTTTTGATGTAAAAATTTAGGTGCTGTTTGCTTA
Associated Phenotype:
Not determined