Busch Lab

ZMP

si:dkey-249g23.1

Ensembl ID:
ENSDARG00000006892
ZFIN IDs:
ZDB-GENE-070706-2, ZDB-GENE-070912-471
Description:
Novel protein similar to H.sapiens MYO3B, myosin IIIB (MYO3B) [Source:UniProtKB/TrEMBL;Acc:B0S5S5]
Human Orthologues:
MYO9A, MYO9B
Human Descriptions:
myosin IXA [Source:HGNC Symbol;Acc:7608]
myosin IXB [Source:HGNC Symbol;Acc:7609]
Mouse Orthologues:
Myo9a, Myo9b
Mouse Descriptions:
myosin IXa Gene [Source:MGI Symbol;Acc:MGI:107735]
myosin IXb Gene [Source:MGI Symbol;Acc:MGI:106624]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa27329 Nonsense Mutation detected in F1 DNA Not yet available
sa7171 Nonsense Mutation detected in F1 DNA Not yet available
sa34546 Nonsense Mutation detected in F1 DNA Not yet available
sa15983 Nonsense Available for shipment Available now
sa41340 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa27329
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010378 Nonsense 220 1124 6 27
ENSDART00000141492 None None 889 None 22
Genomic Location (Zv9):
Chromosome 9 (position 3864646)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3881025
GRCz11 9 3852554
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGTGTGAACAGCAGTATGACTACTCGTATGACGCCCGCTGTGATGTGTG[G/A]TCGCTGGGCATCACTGCTATAGAGCTGGCAGACGGAGACCCACCACTGGC
Long Flanking Sequence:
AATTCCTGAAGAGCCCTGCACAGTTTAGTTCCAACCCTGCTCCAACACACTTACCTGTAGGTTTCAAACAAGCCTGAAGGACTCAATTAGTTTGATCAGGTGTGTTTAATTAGGGTTGGAATTAAACTGTGCAGAGCTGCGGCCCTTTTGGAACTGAGTTTGACACCTGTGGTTTGAGCCGTCGATGTCAGAAATTAAAAATAAGATGAAAGTCTGGGAATTTGACATTTGGCGCAAATCAAAAACATAAATCAAAATGCATCAAAAATGCGTGAAAATTGTGTTAGTCTGAAACTCTAAACAAGATTTGTGAGAATACCATTGTATCCCATGCCCATTTAATCTAAATGCCATCGCATAAACTTGATCCCTATGGTGAGCTTTGTTTTGTGTTGACGGTGAATATCTTGTGTTCATGATTCCTCTTTGGTTGTCTGTGTGCAGGTGATAGCGTGTGAACAGCAGTATGACTACTCGTATGACGCCCGCTGTGATGTGTG[G/A]TCGCTGGGCATCACTGCTATAGAGCTGGCAGACGGAGACCCACCACTGGCAGAGATGCACCCGGTCAAAGCACTCTTCAAAATACCACGGTAAGACAGCAGGGGGAGCTAAACACACACAACACTCACAAAACTCAGAGGGAAAAGTGAGAGACTGAGGGAAAAGTGGGATATGGGAATGTCATGGATGAGAAGGAAAGATAGCAAATGTCACCTGCATACTCATTGAAACACTTGAATCAGAGATTGAGGTTTATGAAACTTACTGAAATTCAGAAAATATTTTTTTATTCAGCCAAGCACAGTGATATTTCCTACAGACCCAACATTAAATATAAAAAATATATATTTTCTTACAGTTTTTGTCTTGTTTTGAGTGCAAATATCAAAACATTTTTCAATCAAGATACATTTTCTAGACGAGCAAAAAAAAAAAGTATAGTCTTGTTTTCTAAAATAGTAATATGAATCAAAATTTAGTTGTTTTTTTTTAATAAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7171
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010378 Nonsense 509 1124 13 27
ENSDART00000141492 Nonsense 260 889 7 22
Genomic Location (Zv9):
Chromosome 9 (position 3811677)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3843698
GRCz11 9 3815227
KASP Assay ID:
554-5269.1 (used for ordering genotyping assays)
KASP Sequence:
TGGAGATGAAGTTTACTCCTACAGGAGCAGTGATGGGTGCCAAGATCTCA[G/T]AGTAWCTTCTGGAGAAATCRAGAGTCATCAAACAGGCTACGTGAGAAAAC
Long Flanking Sequence:
TACATTGCATACATATTACTGCCTGTGCACGAGAAAACTTAACCATCAGTTTAGTGGCTAGTTTGTCCGAATTTGTACCAGTTCAGTCGTACGAAAATTTGTGATTTTCAAAATGAGGCATGAGACCACACTTCACCCCTAAACCCAACCATCATTAGAGGATGAGCAAATCGAACTAAATTGTACAAATGAGATCATACGAAATCATACAAATTAGCCACTAAACCAAAAAGTTACGATTTGCCTTCATAACATTTCATTAACTGATCCTCAACTATCGCAGATTACAAATCTAGGCAGCGCTCTTCAAACGGCAAACTGTTGTTCTCTTTTTCAAGGCTAACAATCGCACACTCCGCGAGAAGATTCTTCAAGTCAATCCCCTGGTGGAGGCGTTTGGTAACGCATGCACGGCTATTAACGATAACTCCAGCCGCTTCGGAAAGTATCTGGAGATGAAGTTTACTCCTACAGGAGCAGTGATGGGTGCCAAGATCTCA[G/T]AGTATCTTCTGGAGAAATCAAGAGTCATCAAACAGGCTACGTGAGAAAACATTTCGTTTACATCTGTGATTGTCAGAGACTAACATAAAATACTTTATGCAATTCATGTTACTACTGTAATGTGACTTATTTTCCGAGTGAAGCATAATGTTAGCAATTAAATACAAGTATGGCAGGTCTGGATTTTACACATGGATGGGATGTAGATTTTTTTTAGAGATTATTTTAGCGAAAAGGGACCTATTACACAAAAAACACTTTTATGAGGGGTTCAAACAGGTGTGTGGCAACAGTGTGTGAATATAACTAATAGTAAAAATTACTAATATATTTTTTTATAATCATGCTTCTTAAAATAGTCTAAGAAAAACCCATTTTGATTTACTTTCTCTCTTAGTAGATGTCATCAGAGGGGGAAAGCCCCGCCCATTAGTGAAAATCTCTCCCTCATTAGCATAAACAGCCCTGAGTGAGAAGCAGACGATTTGAATCTGGCGCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3708
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010378 Nonsense 510 1124 13 27
ENSDART00000141492 Nonsense 261 889 7 22
Genomic Location (Zv9):
Chromosome 9 (position 3811672)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3843693
GRCz11 9 3815222
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGAAGTTTACTCCTACAGGAGCAGTGATGGGTGCCAAGATCTCAGAGTA[T/A]CTTCTGGAGAAATCRAGAGTCATCAAACAGGCTACGTGAGAAAACATTTC
Long Flanking Sequence:
TGCATACATATTACTGCCTGTGCACGAGAAAACTTAACCATCAGTTTAGTGGCTAGTTTGTCCGAATTTGTACCAGTTCAGTCGTACGAAAATTTGTGATTTTCAAAATGAGGCATGAGACCACACTTCACCCCTAAACCCAACCATCATTAGAGGATGAGCAAATCGAACTAAATTGTACAAATGAGATCATACGAAATCATACAAATTAGCCACTAAACCAAAAAGTTACGATTTGCCTTCATAACATTTCATTAACTGATCCTCAACTATCGCAGATTACAAATCTAGGCAGCGCTCTTCAAACGGCAAACTGTTGTTCTCTTTTTCAAGGCTAACAATCGCACACTCCGCGAGAAGATTCTTCAAGTCAATCCCCTGGTGGAGGCGTTTGGTAACGCATGCACGGCTATTAACGATAACTCCAGCCGCTTCGGAAAGTATCTGGAGATGAAGTTTACTCCTACAGGAGCAGTGATGGGTGCCAAGATCTCAGAGTA[T/A]CTTCTGGAGAAATCAAGAGTCATCAAACAGGCTACGTGAGAAAACATTTCGTTTACATCTGTGATTGTCAGAGACTAACATAAAATACTTTATGCAATTCATGTTACTACTGTAATGTGACTTATTTTCCGAGTGAAGCATAATGTTAGCAATTAAATACAAGTATGGCAGGTCTGGATTTTACACATGGATGGGATGTAGATTTTTTTTAGAGATTATTTTAGCGAAAAGGGACCTATTACACAAAAAACACTTTTATGAGGGGTTCAAACAGGTGTGTGGCAACAGTGTGTGAATATAACTAATAGTAAAAATTACTAATATATTTTTTTATAATCATGCTTCTTAAAATAGTCTAAGAAAAACCCATTTTGATTTACTTTCTCTCTTAGTAGATGTCATCAGAGGGGGAAAGCCCCGCCCATTAGTGAAAATCTCTCCCTCATTAGCATAAACAGCCCTGAGTGAGAAGCAGACGATTTGAATCTGGCGCACAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34546
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010378 Nonsense 804 1124 19 27
ENSDART00000141492 Nonsense 554 889 13 22
Genomic Location (Zv9):
Chromosome 9 (position 3795994)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3828015
GRCz11 9 3799544
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTACTGTCTTTACTGGATGAGGAGAGCCGATTCCCACAGGCCACTGAC[C/T]AAACTCTTGTCGGTAATGAGCAATTCCATGCAAATGTCAACCTTGCCATA
Long Flanking Sequence:
CTGGATGTGTTTTTTTTTTTTTTTTTGTAGCCTCCAAACTTCATGCGCTTTTGCTTTGCTAAGCTAACTCTGTAGAAGCCAATGTCTCTCTTTGCATAAAATTTTGAGAGTATTACATTCAGAGATGTTGTTTATGTTCCAAACAGCTACATTACACATCAACAAAGTTTAAAATATGATATCGTTGTGAACCACCCCTTTAAATTTGAGTTGGGGAAACCCACGTATGAAATAAGAACTGTACTTCATGGCAACTTTAATAGCATTTCTTTTTGTTTTGTATCTATGAAATGACAAATTCTCCACATCAGTTATTTGCTCAGGGAGATTCTGTTGATGTGTATGTTGTGTTTGTTCAGATAGAGTATCAGAGTGAGGGTGTAGATGTCAGTCTGGTGGAATACGAGGACAACAGGCCCATTCTGGACATGTTTCTTCAGAAGCCCATGGGTTTACTGTCTTTACTGGATGAGGAGAGCCGATTCCCACAGGCCACTGAC[C/T]AAACTCTTGTCGGTAATGAGCAATTCCATGCAAATGTCAACCTTGCCATAAACAAGATTAAGTTTTCATCCAAAATAGCGTAATGGTTTCTACATTTTTTTTGTGTGTAAGCAAGTATTATACAGTAGTTTAAAAAATACTCAAAAAAAATCTCTGTCAGTGTTTTCAATCAATTATATTTGATTTACCAAAGTCACACAAGTGCTGATTTCACGTCTGTCAGAGAGATGTCACATCCATAACCAAGCTTTTTCCACATAAATGCAAAAATATAAAATCAAATCAATCATGTTTGTTCTATAAAGAGCCGACTTCTCCTTTTGATTAGCATTGTTGTGCAGTTGAATTCATAGAATTTCTACAAAGTTTTTTGTATAGACCTTTTTCTTGGAACGCAAAATTACCCATTATGCTTTGTGTGTATGCGCAAGGAGAATGCGAAGAACTTCCGGTCACATTTGGACAGCTTTGAAACGCTAGTTTTAATCTATTTTACCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15983
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010378 Nonsense 870 1124 21 27
ENSDART00000141492 Nonsense 620 889 15 22
Genomic Location (Zv9):
Chromosome 9 (position 3792000)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3824021
GRCz11 9 3795550
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCTGCAGACATCGTGGTGGTTTTGAGGACATCKGAGAACAGACTTCTG[C/T]WGCAGCTGWTTTCCAGCCCTCTGACAAAARCAGGTACCAGAGTCATTCAG
Long Flanking Sequence:
AATAGTACCATGAGCACTTATATGTCAAAAGATCAAGGGAAGTTTGGTTTTTTAATTTACTGGGCCTTTAAAAAAAAGGCAGCTACTTACACATGATCAGTCAGAAACGGTTTTAATATGCTGACTTACTGATCATGAAACATTTCCCGTTGTTATCAAAGTGAAAAGAATTGTACTGCCTAATATATTTGTGTGGAAACTGGATTTTTCAGGATTCATTCATACATAGAAAGCTTGGCAGTGTTTGTTTAAACAGAAATAATTTGTATTATTGTAGCTGCTGCTATTTTTTTTTAAGAATGAGGCCTTGGTAAATAAATGAAACTATAAACAAACTATTTTTTTATATTTAAAAAAAGTGTGCAGTAATTCAACTTTTAAAATGTCCTGTGTTTCTCTGCCAGGTCTTGTATAACGTGAGTGGATTTCTGGAGAAGAATCGTGACACTCTTCCTGCAGACATCGTGGTGGTTTTGAGGACATCGGAGAACAGACTTCTG[C/T]AGCAGCTGTTTTCCAGCCCTCTGACAAAAACAGGTACCAGAGTCATTCAGCGCTGATCATGAGCTGTTCATGTTCATCACTATCACTTCTCAATCATACAGACATATCTCAGCCAGTTTACACTTGATAGTAAACATTTTTCTCCATGTGATCACATGTGGACGATGCTAACTCCAAGTGTCTAACAAATCAATTGGGTTGCTTTCATGTTGTGGAGCGGTTTTCCTCATGGGGAACAAAAAATGTCCCCACAAGTGTACAGTGTACAGATTATTTAATCTATCATCCACCCCAACCCTAACCCTCACATGAAACATTCAGCAATTTTACATTTCCAAAATGCATGATTCTCTATACATTATAAGCAGTTTTCCTCATGGGGACCAAAAAATGTCCCCTCAAGGTCAAAACTGACTGGTATTTCTATACTTGTGGGGACATTTGTTCCTTTCAACGTATGGAATACAAGGTACACACACATTCTCTTTATATAGTAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41340
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010378 Essential Splice Site 908 1124 23 27
ENSDART00000141492 Essential Splice Site 658 889 17 22
Genomic Location (Zv9):
Chromosome 9 (position 3767095)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3799116
GRCz11 9 3770645
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTATTGGCGGTGCAGAAACGCTACAGTAAGTGTGTTTGTGTGTGTTTA[G/A]GTGGACACCATGGAAATGATGCGTCACCCTGAAGAAACCACTAACATGAG
Long Flanking Sequence:
TCTAATGGCTGGGAATTACCAATTTTACAGTGTCTGCTATGTTGTATGAATATGGCCACGGTGGCCACGGTGTAAATGCACAGCACGGTTACGATCTTATTGCCACATTATATGGCATTTCACTGATCTTCTCTTATAAGGAAAGAGCACATTATTTTGCGGCCACAGCGGGGTGCCCAAATTATTGCATAAGACTGTATTTATACCATATTTATATGTTTTAACTGATTTAATCTAATAGTATTCCATGTTTACAGACATTTAAAAAAACGGACATATTAAATAAAATTAAAAAGTTACATACAGTTAATGATACACTTCATTGTGATTCATTTCTTGAGTGCTTATGCCATCCAGCAGATGAAACAAAGCTCCCAATTTTGGGACTGTTCCCTAAAATGCAGGACAGGTGGTACAGAATAAAACCAGGACTGTAGAAGTACTGTATGTGTGTATTGGCGGTGCAGAAACGCTACAGTAAGTGTGTTTGTGTGTGTTTA[G/A]GTGGACACCATGGAAATGATGCGTCACCCTGAAGAAACCACTAACATGAGGAGACAGACAGTGGCGTCTTATTTCAGGGTGAGTCCTCGGCAAGTCACATTGTAGAAAAATGTGCATGTATACAGACGTGGACAAAACTGTTGATACTCTTCCATTGAATAAGCACCTCACACCGTCACTTGCTGCCACAAAGTTAGTGGCTACGCAGGAGATAACGTAAGCTCTACTACCAAAGGAGGAGATGACGCCACGATGTCAAAGCAAATAAAAAGTGATTTTTCTCCACCACAAACCCTTATTACTCAGACAGAATTACACAATATAATACTTTTATTAAAGGAGCCTGCCCAACACCACTGAAATCTATCAATAGCCAACTGTCAGCTTGCCCTGCTGAAAAATCCAGCTTAAACCAGACTAGGCTGGTTGGCTGGTTTAAGCTGGTCGACCAGGCTGGTTTTAGAGGGGTTTTGGCCATTTCCAGGCTGGTTTCCAGTCAT
Associated Phenotype:
Not determined