Busch Lab

ZMP

kifap3

Ensembl ID:
ENSDARG00000006862
ZFIN ID:
ZDB-GENE-030131-2219
Description:
kinesin-associated protein 3 [Source:RefSeq peptide;Acc:NP_001137517]
Human Orthologue:
KIFAP3
Human Description:
kinesin-associated protein 3 [Source:HGNC Symbol;Acc:17060]
Mouse Orthologue:
Kifap3
Mouse Description:
kinesin-associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:107566]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa9250 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9250
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026800 Nonsense 685 772 18 20

The following transcripts of ENSDARG00000006862 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22732357)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23619062
GRCz11 2 23274713
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGGAAGAAGATCCAAAGCGAGAAGTTTCGCTGGCATAACTCGCAGTGGT[T/A]GGAGATGGTGGAGAGCAGACAGATGGAGGACGGCGAGCCCTACATGTATG
Associated Phenotype:
Not determined