Busch Lab

ZMP

si:ch211-153j24.6

Ensembl ID:
ENSDARG00000006812
ZFIN ID:
ZDB-GENE-041014-277
Description:
WD repeat-containing protein 26 [Source:UniProtKB/Swiss-Prot;Acc:Q5SP67]
Human Orthologue:
WDR26
Human Description:
WD repeat domain 26 [Source:HGNC Symbol;Acc:21208]
Mouse Orthologue:
Wdr26
Mouse Description:
WD repeat domain 26 Gene [Source:MGI Symbol;Acc:MGI:1923825]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa23806 Essential Splice Site Available for shipment Available now
sa37155 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9037 Nonsense Mutation detected in F1 DNA Not yet available
sa43528 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23806
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029894 Essential Splice Site 102 576 2 14
Genomic Location (Zv9):
Chromosome 20 (position 46954751)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46800034
GRCz11 20 46703754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAGCCACAAAGTTTCGAAACCACGTCATGGAAGGTGAATGGGACAAGG[T/G]GAGGATTCTCAATCCATACGCAACTTGCATGTAAAGCAGAAAACATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37155
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029894 Essential Splice Site 167 576 4 14
Genomic Location (Zv9):
Chromosome 20 (position 46963869)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46809152
GRCz11 20 46712872
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTGACTCCCCTCAAATACAACACGGATCGAATCCATGTGCTCAGCGGG[T/A]ACTAAACAGCACGCATTAACATGCTTTATTAAAACATGCATTACTGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9037
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029894 Nonsense 192 576 5 14
Genomic Location (Zv9):
Chromosome 20 (position 46964061)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46809344
GRCz11 20 46713064
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATCTGAAGGCAAAGGCTGAGTGGGAGGGAAAAGGAGCTGGATCACGATG[T/A]AGATTATTGGACAAGCTCCAGAGTGAGTATNNNAAAAACGMACACATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43528
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029894 Nonsense 404 576 10 14
Genomic Location (Zv9):
Chromosome 20 (position 46972033)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46817316
GRCz11 20 46721036
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGGGAATCTGCTGGAGTCATGGGAAGGTGTTCGTGTGCAGTGTCTGTG[G/A]TGTATGGGCGACGGACGGACGGTCCTGGCCTCTGATACACACCAGCGGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6650
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029894 Nonsense 515 576 13 14
Genomic Location (Zv9):
Chromosome 20 (position 46975645)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46820928
GRCz11 20 46724648
KASP Assay ID:
554-4681.1 (used for ordering genotyping assays)
KASP Sequence:
NNTCTCTCTCTCTCTCAGATCATAAGGTATATATTTGGCACAAGCGCAGC[G/T]AGCTGCCGAWCGTGGAGTTGACGGGACACACGCGCACAGTGAACTGCGTC
Associated Phenotype:
Not determined