Busch Lab

ZMP

si:dkey-121j17.1

Ensembl ID:
ENSDARG00000006797
ZFIN ID:
ZDB-GENE-030131-8274
Description:
5'-nucleotidase domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001098413]
Human Orthologue:
NT5DC1
Human Description:
5'-nucleotidase domain containing 1 [Source:HGNC Symbol;Acc:21556]
Mouse Orthologue:
Nt5dc1
Mouse Description:
5'-nucleotidase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2442446]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa17741 Nonsense Available for shipment Available now
sa44928 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12281 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17741
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026794 Nonsense 107 461 4 12
ENSDART00000138585 None None 278 None 6
Genomic Location (Zv9):
Chromosome 20 (position 497687)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 491471
GRCz11 20 481318
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCACGAAAAACCTGAGCACAGATGAMATCGTAAAGCATTACGGCCCAAAG[C/T]GAGAATGGAAGCATTTTAATAGCCTCAATACTTCGTACACTCGATCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44928
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026794 Essential Splice Site 149 461 5 12
ENSDART00000138585 None None 278 None 6
Genomic Location (Zv9):
Chromosome 20 (position 500123)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 493888
GRCz11 20 483735
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTGCCCGGCGCTCTTCTCTGTGCCAGAGTGGTGGACATGATGAATAAG[G/A]TAAAGCAGCTCATATCTAATGCAGATCAGAGGTGCTGTTTGTTAATTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12281
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026794 Nonsense 368 461 10 12
ENSDART00000138585 Nonsense 185 278 4 6
Genomic Location (Zv9):
Chromosome 20 (position 542620)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 535895
GRCz11 20 525742
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTAACAGCAGCAGTGGCGGCCCGAGCGAAGGGCCGGTGGAGAAAAAGGCC[A/T]AGTTTGAGGTGAGACTGAAAAAGCTCTTTCGGTTTAGCCAAGCTCRGGAT
Associated Phenotype:
Not determined