Busch Lab

ZMP

copz2

Ensembl ID:
ENSDARG00000006786
ZFIN ID:
ZDB-GENE-000406-5
Description:
coatomer subunit zeta-2 [Source:RefSeq peptide;Acc:NP_571582]
Human Orthologue:
COPZ2
Human Description:
coatomer protein complex, subunit zeta 2 [Source:HGNC Symbol;Acc:19356]
Mouse Orthologue:
Copz2
Mouse Description:
coatomer protein complex, subunit zeta 2 Gene [Source:MGI Symbol;Acc:MGI:1929008]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6885 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19997 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6885
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002177 Essential Splice Site 71 199 None 11
ENSDART00000078615 Essential Splice Site 52 172 None 8
ENSDART00000131509 Essential Splice Site 53 173 None 9
ENSDART00000138270 Essential Splice Site 58 189 None 10

The following transcripts of ENSDARG00000006786 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 24388833)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23967044
GRCz11 3 24097592
KASP Assay ID:
554-4102.1 (used for ordering genotyping assays)
KASP Sequence:
CAGAARAATTTTGAGAAGAACGTCTTCAACAAAACACACAAAGCTGACAG[T/C]AAGTCGATTATTTTATAGGCTCTGTGTTGCMTTTTAATCGGTATCCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19997
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002177 Nonsense 92 199 5 11
ENSDART00000078615 Nonsense 73 172 3 8
ENSDART00000131509 Nonsense 74 173 4 9
ENSDART00000138270 Nonsense 79 189 4 10

The following transcripts of ENSDARG00000006786 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 24392002)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23970213
GRCz11 3 24100761
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGAGGGAATGACGATAGTCTACAAGAGCAGCATAGACCTGTTCTTCTA[T/A]GTAGTCGGCAGCGCTCAGGAGAACGAGGTGAGTCCTGTATGCAGATGAGC
Associated Phenotype:
Not determined