Busch Lab

ZMP

tmprss4a

Ensembl ID:
ENSDARG00000006693
ZFIN ID:
ZDB-GENE-061103-631
Description:
transmembrane protease, serine 4a [Source:RefSeq peptide;Acc:NP_001071206]
Human Orthologue:
TMPRSS4
Human Description:
transmembrane protease, serine 4 [Source:HGNC Symbol;Acc:11878]
Mouse Orthologue:
Tmprss4
Mouse Description:
transmembrane protease, serine 4 Gene [Source:MGI Symbol;Acc:MGI:2384877]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6366 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32017 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2830
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101301 Nonsense 153 430 6 13
ENSDART00000131290 Nonsense 153 154 6 6
ENSDART00000136238 Nonsense 210 309 6 9
Genomic Location (Zv9):
Chromosome 15 (position 13010504)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12520313
GRCz11 15 12451730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCAGCATCGCAGTGGGTCCTTTGCCGTCTGATCTGAAGATRTCTTTCTG[C/A]ATGGTGGGCACAACCAAACCACAGACTTTCCAATCCGCTGTGTCAGATCG
Long Flanking Sequence:
TTATGACATACAGTAGCACACACAAATGCAGTGTTTTAACAGAAAATCCATCCTTACTGAAGTTTTCAAATACGTTTTAGATCACTGTGATTGTGTTTGTAATGTTGATATTTGTTTTAATCTGTTGATAATTGTTTTTAGTCTGATAACATTTCTTCCAAATTTTTAATAAAAATAAAAAAATATAATGCATATTCAATATAATACATATTCACATGTCCTTGTTTATTTATTATTATTATTATTATTATTATTATTATTATTATTATACATTAATAATAATGATCCCAAAAATATTGAATAAATTTTGTCTAAATTTAATATGACAATGCAATATGAAATGTAGTATATGTACATTTTTTATAATTTCTTTCTTTCAAATTCTTTCTTTTATTAAATGCAAGACTTCAGCTCATTACTTTGTTTTTTGTATTCAGTTCTCCAGTTTTCAGCAGCATCGCAGTGGGTCCTTTGCCGTCTGATCTGAAGATATCTTTCTG[C/A]ATGGTGGGCACAACCAAACCACAGACTTTCCAATCCGCTGTGTCAGATCGGTCAGTAGATAAATATGAAACAATAAAAGCAACATTTGATTCAATAATAAAATTATCCCAGTCTCACTTATACTGAAAGATGTGGTCATTATTCAGTTTGATTGTAAACATTGTCATTTTTTTTTTTTTTTCAGTAAGGTATGCAGTACAGGAACTGTCATCTCATTATCATGCTCTGGTAACTATGACATACTAATCCAGGACATTAGTTAATAACCAAAAAAACGTATAATGTTTACCAAGAATAAAGCTCAAAACTCAAAGGTGTGTTTACTAACCGTTAATCATCTGAACTGTGCAATTACAAAGGCTAAAACATGTTTTAAATGTGGAGAAGTTGCTGTTTGTTTTAAAATGTGATCTATAATGCGTGTTAAAATGTGACCTATAAGCTAAAAAAGACATTTTCTGTCTTATTTTGCAGCAGACTGTGGTTTGTCCAGAAACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6366
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101301 Essential Splice Site 170 430 7 13
ENSDART00000131290 None None 154 None 6
ENSDART00000136238 Essential Splice Site 227 309 7 9
Genomic Location (Zv9):
Chromosome 15 (position 13010321)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12520496
GRCz11 15 12451913
KASP Assay ID:
554-5208.1 (used for ordering genotyping assays)
KASP Sequence:
TGGTCATTATTCAGTTTGAKTGTAAACATTGTCATTTTTTTTTTTTTTTC[A/T]GTAAGGTATGCAGTACWGGAACTGTCATCTCATTATCATGCTCTGGTAAC
Long Flanking Sequence:
TATAATGCATATTCAATATAATACATATTCACATGTCCTTGTTTATTTATTATTATTATTATTATTATTATTATTATTATTATTATACATTAATAATAATGATCCCAAAAATATTGAATAAATTTTGTCTAAATTTAATATGACAATGCAATATGAAATGTAGTATATGTACATTTTTTATAATTTCTTTCTTTCAAATTCTTTCTTTTATTAAATGCAAGACTTCAGCTCATTACTTTGTTTTTTGTATTCAGTTCTCCAGTTTTCAGCAGCATCGCAGTGGGTCCTTTGCCGTCTGATCTGAAGATATCTTTCTGCATGGTGGGCACAACCAAACCACAGACTTTCCAATCCGCTGTGTCAGATCGGTCAGTAGATAAATATGAAACAATAAAAGCAACATTTGATTCAATAATAAAATTATCCCAGTCTCACTTATACTGAAAGATGTGGTCATTATTCAGTTTGATTGTAAACATTGTCATTTTTTTTTTTTTTTC[A/T]GTAAGGTATGCAGTACAGGAACTGTCATCTCATTATCATGCTCTGGTAACTATGACATACTAATCCAGGACATTAGTTAATAACCAAAAAAACGTATAATGTTTACCAAGAATAAAGCTCAAAACTCAAAGGTGTGTTTACTAACCGTTAATCATCTGAACTGTGCAATTACAAAGGCTAAAACATGTTTTAAATGTGGAGAAGTTGCTGTTTGTTTTAAAATGTGATCTATAATGCGTGTTAAAATGTGACCTATAAGCTAAAAAAGACATTTTCTGTCTTATTTTGCAGCAGACTGTGGTTTGTCCAGAAACCAGGACCGGATTGTTGGTGGAAAGGATGCTGACATTGCGAACTGGCCCTGGCAGGTCAGCTTGCAGTATAGCGGCCAGCATACATGCGGAGGATCACTGGTGACTCCAAACTGGGTGGTCACTGCGGCCCACTGTTTCAATGGGTGAGTTGACCCAACATTTAAAGGAACATGAAAATGTGGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32017
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101301 Nonsense 249 430 9 13
ENSDART00000131290 None None 154 None 6
ENSDART00000136238 Nonsense 306 309 9 9
Genomic Location (Zv9):
Chromosome 15 (position 13007516)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12523301
GRCz11 15 12454718
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCACATTGTTGTGTGTTGTTTAGGGATGGCAGGAAAGCTCTGAGCCGGT[G/A]GACCGTCGTCTCAGGAATTACGTATCTGAGTTCTACTCCATCTTCATATG
Long Flanking Sequence:
TTTATTCAGAATACTTTTGGATTGCTTTTAAATTAAAAGTAATCCAAAAGTACCTAAAATGATAACTGCATTTTTACTGACAAAATCTAAATATGTTAATTTTGCAGAGTCAACCTAAATACATAGTTATGACACCAAACTATGTTGCGTGTGTTCAATTATGTAAATATGTTTTTAAAGCCAAAAGTCCAGGTTATCAACTTTTATTACTATTTTTTACAGTGTAAGTAAAGATGTGTCATGTAGACAAGCATGTTTTTTATCATTCACTTCCAAAAAATGGTTCATGAATACCAGTCAAGTTCACCTGGTTTACAAACAGTGCTGCATGTCATTCAACATGCAGACAAATAAAAAGCATGAATGTGAATGGTTCATGGTTTACCTAACGATGCTTTGTAAATAGAACTAATCCAGGGTGTGCTCTGAAAAAGGGAATGCATTAAGAAGGTCACATTGTTGTGTGTTGTTTAGGGATGGCAGGAAAGCTCTGAGCCGGT[G/A]GACCGTCGTCTCAGGAATTACGTATCTGAGTTCTACTCCATCTTCATATGTGAAAGAAATCATCGTTAACAGCAATTACAAACCAGCAGAAAGTGACTTTGACATTACTATGATCAAACTTCAGTCTCCAATCACTTTGTCAGGTACAACACACACACAAACACACACACACAACCTTTTTAGCTCCTATCAGTATTGTTTGTTTTTAGGGGATCTATTAGCTAGTGCACTCCAAAACAGTGACAACATTTGCATTTAGAAGATAAACTGATATAAACATGTGAAGCTTGTCACTTCGACCTAAATGGACCAAATTTGGCATAGCTGTGATAAAACACTATTGGCTGTTTTTTAAAAAGGGGAGGGGCTACTCTGTCCCATACTTTCTTTCCGTTGAGATTACATCAAACATCGAATAAAAATGCATATTTTAAAGTACTTCCTGGGACCTTTAATTATAGTAAACAATATATACAGCATATAGCTTTTTTATTTTGTTT
Associated Phenotype:
Not determined