Busch Lab

ZMP

sc:d0319

Ensembl ID:
ENSDARG00000006636
ZFIN ID:
ZDB-GENE-080327-7
Description:
cDNA, clone cssl:d0319 [Source:UniProtKB/TrEMBL;Acc:A8BAV3]
Human Orthologue:
SLITRK2
Human Description:
SLIT and NTRK-like family, member 2 [Source:HGNC Symbol;Acc:13449]
Mouse Orthologue:
Slitrk2
Mouse Description:
SLIT and NTRK-like family, member 2 Gene [Source:MGI Symbol;Acc:MGI:2679449]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa19079 Nonsense Mutation detected in F1 DNA Not yet available
sa11011 Nonsense Available for shipment Available now
sa15552 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19079
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005738 Nonsense 64 854 1 1
ENSDART00000005738 Nonsense 64 854 1 1
Genomic Location (Zv9):
Chromosome 14 (position 20275155)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 18957444
GRCz11 14 19258891
KASP Assay ID:
2260-7452.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAAAACAAGGCTTTTACCACGGTCAGCCTGTTCCAGCCTCCGCAAAAC[A/T]AAATCAGTCAGCTCTTTCTGAATGGAAACTTTCTCACCAAGATAAGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11011
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005738 Nonsense 64 854 1 1
ENSDART00000005738 Nonsense 64 854 1 1
Genomic Location (Zv9):
Chromosome 14 (position 20275155)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 18957444
GRCz11 14 19258891
KASP Assay ID:
2260-7452.1 (used for ordering genotyping assays)
KASP Sequence:
GTGAAAACAAGGCTTTTACCACGGTCAGCCTGTTCCAGCCTCCGCAAAAC[A/T]AAATCAGTCAGCTCTTTCTGAATGGAAACTTTCTCACCAAGATAAGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15552
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005738 Nonsense 334 854 1 1
Genomic Location (Zv9):
Chromosome 14 (position 20275965)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 18958254
GRCz11 14 19259701
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGTCACGTCTAGCAGAGATAAACACGTATTCGGGCCTATCATGGTGTAT[C/T]AGACGCGCTCGCCAGTCCCAATGACCTGTCCGGGCATTTGCGTGTGCACG
Associated Phenotype:
Not determined