Busch Lab

ZMP

brd3a

Ensembl ID:
ENSDARG00000006527
ZFIN ID:
ZDB-GENE-030131-6141
Description:
bromodomain containing 3a [Source:RefSeq peptide;Acc:NP_001116861]
Human Orthologue:
BRD3
Human Description:
bromodomain containing 3 [Source:HGNC Symbol;Acc:1104]
Mouse Orthologue:
Brd3
Mouse Description:
bromodomain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1914632]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37272 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45732 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37272
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026708 Essential Splice Site 222 683 None 13
ENSDART00000126672 Essential Splice Site 222 514 None 11
ENSDART00000130597 Essential Splice Site 222 498 None 10
ENSDART00000135239 Essential Splice Site 222 683 None 12

The following transcripts of ENSDARG00000006527 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 16890503)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18235452
GRCz11 21 18272088
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGCCGCTGTGATACCCAGCATGCCTCCATCACAACCCACGGTTAAAG[T/A]AAGTCACATGACTTCTCTGGACGTCACATGACATATTTAGTGTCGTTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45732
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026708 Nonsense 449 683 9 13
ENSDART00000126672 Nonsense 448 514 9 11
ENSDART00000130597 Nonsense 449 498 8 10
ENSDART00000135239 Nonsense 449 683 8 12

The following transcripts of ENSDARG00000006527 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 16891472)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18234483
GRCz11 21 18271119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACCTCTGACAGCTCCGACTCTGAGGAGGAGAGGGCCACCCGGCTTGCC[G/T]AGCTGCAGGAACAGGTGGGTGCGGAACAGGTGGGTTTCAAAACAAGGACC
Associated Phenotype:
Not determined