Busch Lab

ZMP

rtn1a

Ensembl ID:
ENSDARG00000006497
ZFIN ID:
ZDB-GENE-030131-2426
Description:
reticulon-1 isoform 1 [Source:RefSeq peptide;Acc:NP_001025138]
Human Orthologue:
RTN1
Human Description:
reticulon 1 [Source:HGNC Symbol;Acc:10467]
Mouse Orthologue:
Rtn1
Mouse Description:
reticulon 1 Gene [Source:MGI Symbol;Acc:MGI:1933947]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa42233 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13604 Essential Splice Site Available for shipment Available now
sa45491 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2734
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057441 None None 165 None 8
ENSDART00000057445 Nonsense 46 249 1 7
ENSDART00000076548 Nonsense 46 157 1 8
ENSDART00000076571 None None 203 None 7
ENSDART00000076574 Nonsense 46 818 1 9

The following transcripts of ENSDARG00000006497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31693721)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31339669
GRCz11 13 31470119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGGCCCCATTTCGACGAGATGCGGGACGATCTGCGTGCGCCCAAGCAA[C/T]AATTCCATCCCTTTGAAGGAACCGGCGTTGCCATGGAAACTGCATCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42233
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057441 None None 165 None 8
ENSDART00000057445 Essential Splice Site 62 249 1 7
ENSDART00000076548 Essential Splice Site 62 157 1 8
ENSDART00000076571 None None 203 None 7
ENSDART00000076574 Essential Splice Site 62 818 1 9

The following transcripts of ENSDARG00000006497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31693669)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31339617
GRCz11 13 31470067
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCCATCCCTTTGAAGGAACCGGCGTTGCCATGGAAACTGCATCTACAG[G/A]TAAATTTGGGCTTTTTATAAATGGCCATTGTGTGTTTTAGCGACGACACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7727
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057441 None None 165 None 8
ENSDART00000057445 None None 249 None 7
ENSDART00000076548 None None 157 None 8
ENSDART00000076571 None None 203 None 7
ENSDART00000076574 Nonsense 596 818 3 9

The following transcripts of ENSDARG00000006497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31675587)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31321535
GRCz11 13 31451985
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAAACCCAGGCCCGCAGTAATGGGAACGTCWACAGTGACTCCSGAGAAG[C/T]AGCCCAGTCAGGAGAYGGAGAGTAAAAGCAAAAGCAGTATTGTTAGTTCS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13604
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057441 Essential Splice Site 17 165 2 8
ENSDART00000057445 Essential Splice Site 63 249 2 7
ENSDART00000076548 None None 157 None 8
ENSDART00000076571 Essential Splice Site 17 203 2 7
ENSDART00000076574 Essential Splice Site 632 818 4 9

The following transcripts of ENSDARG00000006497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31653142)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31299090
GRCz11 13 31429540
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTAATTATGTTCATGTTCTTCTCTCTCTTTCTSTCYGTCTTTCTCCWCA[G/A]TGGTAGATCKAGTACACTGGCGGGATCTKAAGCAGTCTGGACTGGTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45491
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057441 None None 165 None 8
ENSDART00000057445 None 107 249 2 7
ENSDART00000076548 Essential Splice Site 105 157 None 8
ENSDART00000076571 None 61 203 2 7
ENSDART00000076574 None 676 818 4 9

The following transcripts of ENSDARG00000006497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31653008)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31298956
GRCz11 13 31429406
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTTCAGTGTGGTGAGTGTTATAGCGTATCTGGCTCTGGCTGTCCTCTC[T/C]GCTACCATCAGCTTCCGAGTCTACAAATCAGTCCTGCAGGCAGTGCAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28138
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057441 Essential Splice Site 94 165 4 8
ENSDART00000057445 Essential Splice Site 178 249 3 7
ENSDART00000076548 Essential Splice Site None 157 4 8
ENSDART00000076571 Essential Splice Site 132 203 3 7
ENSDART00000076574 Essential Splice Site 747 818 5 9

The following transcripts of ENSDARG00000006497 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31652718)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31298666
GRCz11 13 31429116
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGCTCCGCAGGCTGTTCCTGGTTCAAGATCTGGTCGACTCCATTAAG[G/C]TGAAAAATGGCTATGAACATTTCACTCATGAATATTTTGTTTCTATTTTT
Associated Phenotype:
Not determined